ID: 1047951433

View in Genome Browser
Species Human (GRCh38)
Location 8:129939250-129939272
Sequence GGACAACGCCGACACGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047951417_1047951433 20 Left 1047951417 8:129939207-129939229 CCGCGAAGAGGAAGGAGTGGTGG 0: 1
1: 0
2: 2
3: 15
4: 217
Right 1047951433 8:129939250-129939272 GGACAACGCCGACACGGGAAGGG No data
1047951429_1047951433 -6 Left 1047951429 8:129939233-129939255 CCAGGATTGGGGAGGGGGGACAA 0: 1
1: 0
2: 2
3: 23
4: 255
Right 1047951433 8:129939250-129939272 GGACAACGCCGACACGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047951433 Original CRISPR GGACAACGCCGACACGGGAA GGG Intronic
No off target data available for this crispr