ID: 1047953251

View in Genome Browser
Species Human (GRCh38)
Location 8:129953240-129953262
Sequence CCTGACCTTCCCAAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 283}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047953251_1047953262 3 Left 1047953251 8:129953240-129953262 CCTTCCAGCTTGGGAAGGTCAGG 0: 1
1: 0
2: 2
3: 30
4: 283
Right 1047953262 8:129953266-129953288 GGGTGGCAGGGAGATGTCCAGGG No data
1047953251_1047953263 7 Left 1047953251 8:129953240-129953262 CCTTCCAGCTTGGGAAGGTCAGG 0: 1
1: 0
2: 2
3: 30
4: 283
Right 1047953263 8:129953270-129953292 GGCAGGGAGATGTCCAGGGAAGG No data
1047953251_1047953260 -9 Left 1047953251 8:129953240-129953262 CCTTCCAGCTTGGGAAGGTCAGG 0: 1
1: 0
2: 2
3: 30
4: 283
Right 1047953260 8:129953254-129953276 AAGGTCAGGGGAGGGTGGCAGGG No data
1047953251_1047953259 -10 Left 1047953251 8:129953240-129953262 CCTTCCAGCTTGGGAAGGTCAGG 0: 1
1: 0
2: 2
3: 30
4: 283
Right 1047953259 8:129953253-129953275 GAAGGTCAGGGGAGGGTGGCAGG No data
1047953251_1047953261 2 Left 1047953251 8:129953240-129953262 CCTTCCAGCTTGGGAAGGTCAGG 0: 1
1: 0
2: 2
3: 30
4: 283
Right 1047953261 8:129953265-129953287 AGGGTGGCAGGGAGATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047953251 Original CRISPR CCTGACCTTCCCAAGCTGGA AGG (reversed) Intronic
900777202 1:4594148-4594170 TCTGGCCCTCCCCAGCTGGAAGG + Intergenic
900886883 1:5421448-5421470 CCTGAACATCCCAAGCCGAAAGG - Intergenic
901609997 1:10490452-10490474 GCTGACCTTCCCCAACTGGAAGG - Intronic
902070004 1:13726291-13726313 GATGACCTTTCCATGCTGGACGG - Intronic
902459326 1:16560909-16560931 GCTGAAATTCCCAAGATGGAAGG - Intergenic
903152521 1:21421590-21421612 GCTGAAATTCCCAAGATGGAAGG - Intergenic
903160610 1:21486395-21486417 GCTGAAATTCCCAAGATGGAAGG + Intergenic
903362365 1:22784637-22784659 CAAGACCTTCCCCAACTGGATGG + Exonic
903641835 1:24865470-24865492 CCAGATCTTCCCACTCTGGATGG - Intergenic
903679933 1:25089805-25089827 TTTGACCTTCCCAAGCTCCAGGG + Intergenic
904112337 1:28136026-28136048 CATTACCTTCCCAAGTTGGGCGG + Intergenic
904158077 1:28501500-28501522 CCTCAGCTTCCCAAGCTGCTGGG - Intergenic
904274040 1:29368956-29368978 CCTGCCCTGTCAAAGCTGGATGG + Intergenic
904484543 1:30816179-30816201 CCTGCCCCTGCCAAGGTGGAGGG + Intergenic
905345165 1:37306329-37306351 CCCCACCTAGCCAAGCTGGAAGG + Intergenic
906068051 1:42996369-42996391 CCTTACCTTCTCAGGCTCGATGG - Intergenic
907091752 1:51731333-51731355 CCTCAGCTTCCCAAGCAGGTGGG - Intronic
908345798 1:63231246-63231268 CATGGCCATCCCAAGCTGCAAGG + Intergenic
909407666 1:75310480-75310502 CATGACCATCCCTACCTGGAAGG + Intronic
913419402 1:118648429-118648451 CTTGACATTCTCAAGCTGTAAGG - Intergenic
913606263 1:120469249-120469271 GCTGAAATTCCCAAGATGGAAGG + Intergenic
914210173 1:145570900-145570922 GCTGAAATTCCCAAGATGGAAGG - Intergenic
914269090 1:146063266-146063288 GCTGAAATTCCCAAGATGGAAGG - Intergenic
914368007 1:146997600-146997622 GCTGAAATTCCCAAGATGGAAGG + Intergenic
914484973 1:148100606-148100628 GCTGAAATTCCCAAGATGGAAGG - Intergenic
914584937 1:149052593-149052615 GCTGAAATTCCCAAGATGGAAGG - Intergenic
916497837 1:165361099-165361121 GCTGTCCTTGCCAGGCTGGAGGG - Intergenic
916586764 1:166156101-166156123 CCTGACCTTTCAGAGCTGGCTGG - Intronic
916671267 1:167023167-167023189 CCTCAGCTTCCCAAACTGGTGGG - Intergenic
917498458 1:175564266-175564288 TCTGACCACCCCAAGCAGGACGG + Intronic
920195985 1:204227778-204227800 CCTGACCTGCCCAAGCAGAATGG + Intronic
920987968 1:210908430-210908452 CCTGAGCTTCCCAGGAGGGATGG + Intronic
921203120 1:212825626-212825648 ACTGACCTTCCCAAGCAAGAAGG + Intergenic
921258349 1:213362842-213362864 ACTGACCTCCCCAAGCAAGAGGG + Intergenic
1063879612 10:10517643-10517665 CCTACCCTTCCCATGCTGCAGGG - Intergenic
1065398185 10:25264341-25264363 CCTGACATTTCCAAGCTGCAGGG + Intronic
1065847505 10:29758146-29758168 TCTGCCCTTCAGAAGCTGGAAGG - Intergenic
1066137029 10:32458597-32458619 CCTCAGCTTCCCAAGCTGCTGGG + Intronic
1067275238 10:44828022-44828044 CCTGACCTACCCAGGCTGGAGGG - Intergenic
1067803884 10:49380099-49380121 GCTGACCTTCCCAGGTGGGAGGG - Intronic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1071361013 10:84845985-84846007 CCTGACCTTCTCAAAGCGGAAGG - Intergenic
1071600278 10:86955616-86955638 CCTCCCCTTCCCATGCTGCAGGG + Intronic
1073222567 10:101887998-101888020 CTTGACCTTCCCAAGCTGCTGGG + Intronic
1074326639 10:112456905-112456927 CTTGTCTTTCCCAAGCTGGGTGG + Intronic
1075285970 10:121186301-121186323 CATGACCTGTCCAAGCTGGAAGG + Intergenic
1077053824 11:580367-580389 CCTGCCCTTCCCACTCTGCAAGG - Intronic
1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG + Intronic
1077895862 11:6452775-6452797 CCTGAGCTGCTCAAACTGGAGGG - Intronic
1081210106 11:40322494-40322516 CCTCACCCTCCCAAACTGCAAGG + Intronic
1082216631 11:49578367-49578389 CCTGATCTTCTGAAGCTAGAAGG - Intergenic
1083062956 11:59893605-59893627 CCTCACCTTCCCAAAGTGGTGGG + Intergenic
1084748890 11:71190818-71190840 CCTCACTTTCCCCATCTGGAAGG + Intronic
1085618433 11:78019565-78019587 CCTGAGCCTCCCAAGCAGGTGGG + Intronic
1087269067 11:96092746-96092768 CCGGGCCTTGCCAAGCTGGCAGG - Exonic
1088558035 11:111082835-111082857 TCTGTCCTTCCCATGCAGGAGGG - Intergenic
1089625515 11:119748529-119748551 CCTCACCTGGCCCAGCTGGAGGG + Intergenic
1090966014 11:131598101-131598123 CCTGCCCTTTCCAGGCTGGAAGG + Intronic
1091628025 12:2137797-2137819 CTTGACCTTTCCAAGATGGGTGG + Intronic
1094486028 12:30926668-30926690 GCTGACCTTCCCGGGCTGGGAGG + Intronic
1098899315 12:76096812-76096834 CCTGAGCCTCCCAAGCTGCTGGG - Intergenic
1100616394 12:96234839-96234861 CCTGGGCTTCCAAAGCTGGAGGG + Intronic
1100741365 12:97596977-97596999 CATGAACTTCCCAAGTTGAAGGG + Intergenic
1100758339 12:97777100-97777122 CCTGACATTCCTAAGGTGGGCGG - Intergenic
1101764073 12:107682521-107682543 CCTGCCCCTCCCAAGTTGGCGGG - Intergenic
1108464614 13:50702246-50702268 CCTCAGCTTCCCAAGCTGCTGGG - Intronic
1110745310 13:79046377-79046399 TCTGACCTTCGGAAGCTGAATGG - Intergenic
1112903363 13:104387166-104387188 GCTGACCTTCCTAATCTGGATGG - Intergenic
1113549185 13:111178690-111178712 CCTGCCTTTTCCAAGCTGGGTGG - Intronic
1113868824 13:113545933-113545955 CAGGACATTCCCAAGCAGGAAGG + Intronic
1114346845 14:21805520-21805542 CCTGAGCTTCCCAAGCAGCTGGG - Intergenic
1114719548 14:24866180-24866202 ACTGACCTCCCCAAGCAAGAAGG + Intronic
1118900381 14:69980963-69980985 GCTGTCCCTCCCAGGCTGGAAGG + Intronic
1121043233 14:90767554-90767576 CCTTATCTTCCCATGGTGGAAGG - Intronic
1121523588 14:94602953-94602975 CCTCACCTTCCCATGCAGGTGGG + Intronic
1121645193 14:95513661-95513683 CCTGACCCTCCCATCCTGAAAGG - Intergenic
1122207763 14:100156705-100156727 CCAGACCTGGCCCAGCTGGATGG - Intronic
1122228856 14:100295128-100295150 CCTGACATTCCCCAGCCGGCTGG - Intronic
1124004275 15:25783962-25783984 ACTGGCCTTCGTAAGCTGGACGG - Intronic
1124173710 15:27402580-27402602 GCTGAGCTTCCCATCCTGGAAGG - Intronic
1124811362 15:32942163-32942185 CCTGCCTTTCCCACTCTGGAAGG - Intronic
1124820839 15:33044313-33044335 TCAGACCTTCCCCAGCTTGAAGG - Intronic
1124889360 15:33717941-33717963 CCATCCCTTCCCAGGCTGGAAGG + Intronic
1124896879 15:33785697-33785719 CCTGACATCCCCCAGCTGGAAGG + Exonic
1125721400 15:41846828-41846850 CCCACCCTTCCCAACCTGGAAGG - Exonic
1125755398 15:42060752-42060774 CCTGACTTTCCCAAGATCCAGGG - Intergenic
1130161471 15:81405261-81405283 ACTGCCCTCCCCAAGCAGGAAGG + Intergenic
1130322610 15:82853511-82853533 CCTGCCCTGCCCGACCTGGAGGG - Intronic
1132204147 15:99975024-99975046 CCTGAAGTTCCCAAGCAGGCCGG + Intronic
1132670773 16:1101520-1101542 CCTGTCCCTCCCAGACTGGAAGG - Intergenic
1133306412 16:4812342-4812364 CATCACCTTCCAGAGCTGGAGGG + Intronic
1134004696 16:10810589-10810611 CCCTCCCTTCCCAATCTGGATGG + Intronic
1135407867 16:22211040-22211062 CATGACCTTACCTAGCTGCAAGG + Intronic
1136116274 16:28096892-28096914 CCTGGCCTTCCCTAGCAGGCAGG + Intergenic
1137044231 16:35641392-35641414 CCTGTCCTGGCCAAGCTGCAGGG + Intergenic
1138358698 16:56407495-56407517 CCTCAGCTTCCCAAGCAGGTGGG + Intronic
1138456864 16:57126032-57126054 ACTGAGCTTCCCAGGTTGGATGG - Intronic
1139778820 16:69334208-69334230 CCTGACCCACCAAAACTGGAAGG + Intronic
1140230678 16:73114906-73114928 CCTCAGCCTCCCAAGCTGTAGGG + Intergenic
1141548500 16:84788300-84788322 TCTGACGTTCACAAGCTGTATGG + Intergenic
1142021994 16:87789598-87789620 CCTGGCCTTCCCCAGCTGAGTGG + Intergenic
1142232848 16:88907811-88907833 CCTGTCCTTCCCACCCTCGATGG + Intronic
1142600212 17:1050206-1050228 CCTGAACCTCCGAAGCTGGGAGG + Intronic
1143358580 17:6349523-6349545 CCTGACTTTCCCAGGCTTGCAGG - Intergenic
1144012540 17:11163507-11163529 CCTCACCTCACCAAGCTCGATGG - Intergenic
1144314989 17:14051285-14051307 CCTGAGCCTCCCAAGCTGCTGGG - Intergenic
1144567761 17:16374083-16374105 TCTGACTTGCCCAGGCTGGAGGG - Intergenic
1144685587 17:17223958-17223980 CCGGACCTTCCCCAGCAGGAAGG + Exonic
1145746679 17:27325188-27325210 CATGACCTTCCCCACCTGGCTGG - Intergenic
1146285515 17:31571786-31571808 CCTGGCCTTTCCAGGCTGCAGGG + Intronic
1146885095 17:36465098-36465120 CCTGCCCTCCCGCAGCTGGAAGG - Intergenic
1147180419 17:38681315-38681337 CCTGAACCTCCCAGGCTGAAGGG - Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148456656 17:47814794-47814816 CCTCCCCTTCCCAAGGTGGCTGG - Intronic
1149592603 17:57842770-57842792 CCTCAGCTTCCCAAGCAGGTGGG - Intronic
1149649171 17:58266020-58266042 CCTGGACATCCCAGGCTGGAAGG - Intronic
1150746026 17:67817426-67817448 CCTCACCTTCCCAAGTAGCAGGG - Intergenic
1151483971 17:74387200-74387222 CCTGACCCTCCCCACCTGGTTGG - Intergenic
1152857712 17:82675678-82675700 CATGTCCTCCCCTAGCTGGAGGG + Intronic
1153473076 18:5468320-5468342 TCAGACCATCCCTAGCTGGAGGG - Intronic
1155213959 18:23626047-23626069 CCTGCCCTTGCCAAGCAGCAAGG + Intronic
1155803539 18:30138739-30138761 CCAGGCCTTACCTAGCTGGAAGG + Intergenic
1157304774 18:46508961-46508983 CCTCACCTTCCCCAGCTGTGCGG - Intronic
1158094576 18:53756194-53756216 CCTGACCTTCCTAGGTGGGAGGG - Intergenic
1159390870 18:67790213-67790235 CCTCAACTTCCCAGGCTCGAGGG + Intergenic
1160810285 19:1010288-1010310 CCTGACCTTCCCGAGCCCGTGGG - Exonic
1161271615 19:3392753-3392775 CCTGCCCTCGCCCAGCTGGAGGG - Intronic
1162109536 19:8392534-8392556 GCTGACCTTCTCAAGCTAGTTGG + Intronic
1162280342 19:9691738-9691760 CCTCAGCTTCCCAAGCTGCTGGG + Intronic
1162730213 19:12714137-12714159 TCTGAAGTTCCTAAGCTGGAAGG + Intronic
1163013690 19:14440954-14440976 CCTGACCTCCCCAAACTGGGAGG - Intronic
1163529859 19:17842826-17842848 CCTGACCTCCCCCAGCTAAAAGG - Intronic
1163821088 19:19496944-19496966 CCTGACCTTCGAAAGCAGGCAGG - Intronic
1164448789 19:28341098-28341120 CCTGACCTTATAAAGCTTGAAGG - Intergenic
1164618138 19:29678730-29678752 CCTGACCTTCCCAGGCGTGGGGG - Intergenic
1165826338 19:38708102-38708124 CCTTTCCTTCCCCAGCTGGAAGG + Exonic
1166384287 19:42371516-42371538 CCTGACCTCCACAAGGTGTAGGG - Intronic
1166726907 19:45034041-45034063 CCTCAGCTTCCCAAGTAGGAGGG - Intronic
1167722530 19:51188109-51188131 CCTCCCCTTCCCTATCTGGAGGG + Intergenic
1168045720 19:53792889-53792911 CCTGATCCTCCCTTGCTGGAGGG - Intergenic
1202675570 1_KI270711v1_random:3093-3115 GCTGAAATTCCCAAGATGGAAGG - Intergenic
926953820 2:18272107-18272129 CCTGCCTTTTCCAAGCTGGCAGG - Intronic
928001947 2:27531029-27531051 CCTCAACTTCCCAGGCTGAAGGG - Intergenic
928404036 2:31000635-31000657 ACTGACCTCCCCAAGCAAGAAGG - Intronic
928890875 2:36201593-36201615 CCTCAGCCTCCCAAGCTGGTAGG + Intergenic
930577383 2:53167611-53167633 CCTGAACTTGCCAAGCTGAGTGG + Intergenic
932222244 2:70008798-70008820 CCTGTCCTCCCCAGGCTGGCTGG - Intergenic
932966374 2:76480197-76480219 CCTGAACTCACCATGCTGGAGGG + Intergenic
933052103 2:77612513-77612535 CCTGACTCTCCCAAGCTGGCAGG - Intergenic
933402808 2:81820295-81820317 CCTTAGCTTCCCAAGCTGCTGGG - Intergenic
933995903 2:87669642-87669664 CCTGCCCATCCCAGGCTGGATGG - Intergenic
934662364 2:96150008-96150030 CCGTACCTCCCAAAGCTGGAAGG - Intergenic
935512166 2:103989575-103989597 CCTGGCCTTCCCAAGCAAGAGGG - Intergenic
936297953 2:111281270-111281292 CCTGCCCATCCCAGGCTGGATGG + Intergenic
937954638 2:127415226-127415248 CCTGACCTTCCCAGGCCTGTGGG + Intergenic
939165808 2:138640142-138640164 TCTGACCTTGCAATGCTGGAGGG - Intergenic
939447480 2:142328936-142328958 ACCGACCAACCCAAGCTGGAAGG + Intergenic
942851625 2:180494532-180494554 CCTTCCCTTCCCCAGCTGGGTGG + Intergenic
943636894 2:190317030-190317052 CCTCAGCCTCCCAAGCTGGAAGG + Intronic
943895942 2:193359553-193359575 CCTCAGCTTCCCAAGCTGCTGGG - Intergenic
948226680 2:236316757-236316779 CCTGACCACACCAAGTTGGAAGG + Intergenic
948304108 2:236933860-236933882 CATGGCCTTTCCAAGGTGGAGGG + Intergenic
948592546 2:239060562-239060584 CTTGACCTTTGCCAGCTGGACGG - Intronic
948846457 2:240685085-240685107 CCTGCCCTTCCGCAGCGGGAGGG + Intergenic
948846472 2:240685134-240685156 CCTGAACTTCCCCAGAGGGAGGG + Intergenic
948846486 2:240685183-240685205 CCTGAACTTCCCCAGCAGGAGGG + Intergenic
948846502 2:240685232-240685254 CCCGCCCTTCCCCAGCGGGAGGG + Intergenic
948847360 2:240689501-240689523 CCCGCCCTTCCCCAGCGGGAGGG - Intergenic
948847376 2:240689550-240689572 CCTGAACTTCCCCAGCAGGAGGG - Intergenic
948847390 2:240689599-240689621 CCTGAACTTCCCCAGAGGGAGGG - Intergenic
948847405 2:240689648-240689670 CCTGCCCTTCCGCAGCGGGAGGG - Intergenic
1169150993 20:3289326-3289348 CCTGACCCTCCCAAGTAGGCAGG - Intronic
1169906661 20:10611525-10611547 CCTCACCTCCCCCTGCTGGAAGG - Intronic
1170988021 20:21275820-21275842 CCTCACCTTCCCAAGCAGCTGGG - Intergenic
1171022907 20:21602842-21602864 CCCCAAATTCCCAAGCTGGAAGG + Intergenic
1172283570 20:33725289-33725311 CCTGACCTTGCCAAACTCCAAGG + Intergenic
1172288645 20:33759011-33759033 CCTGACCTTCCCAGTCTCTATGG - Intronic
1172488313 20:35313733-35313755 CCTCACCTTCCCAAGCAGGTGGG + Intronic
1172516174 20:35535482-35535504 ACTGACTTTCCCAAGATGGCAGG - Intergenic
1172538347 20:35691798-35691820 CCTGAGCCTCCCAAAGTGGAGGG - Intronic
1172627115 20:36353600-36353622 CCTCAGCTTCCCCAGCTGTACGG - Intronic
1173198059 20:40932351-40932373 CTTGACCTTACCCAGCAGGAAGG + Intergenic
1173487918 20:43455334-43455356 CCTCAGCTTCCCAAGGTGCAGGG + Intergenic
1173905648 20:46626690-46626712 CCTGACCTTCCCACTCTGCCAGG + Intronic
1173982068 20:47232256-47232278 CCTCACCTTCCCAAGTAGGTGGG - Intronic
1175263549 20:57689386-57689408 CCTGGCCTTCCCAGGCAGAAAGG + Intronic
1175530937 20:59673964-59673986 CCTGGCCTTCCCAAGCTTCGGGG - Intronic
1175676872 20:60953754-60953776 CTTGACATCCCCAAGCTGTAAGG + Intergenic
1175769850 20:61616786-61616808 GCTGACCTTCCCACTCTGCAGGG + Intronic
1175962523 20:62644299-62644321 GCTGACCTTGCCCAGCAGGAAGG - Intronic
1178040462 21:28635215-28635237 CCTGAGCCTCCCAAGCTAGCTGG + Intergenic
1178602623 21:34008046-34008068 CCTCAGCTTCCCAAGCAGGTTGG - Intergenic
1179062734 21:37994796-37994818 CCAGAGCTTGTCAAGCTGGAGGG + Intronic
1179189982 21:39115431-39115453 CCAGAGCTCCCCAAGCTGCAGGG - Intergenic
1180962977 22:19770651-19770673 CATGGACTTCCCCAGCTGGAGGG - Intronic
1181053129 22:20247018-20247040 CATGTCCTGCCCAAGCAGGAAGG + Intronic
1181115700 22:20631576-20631598 TGTGGCCTTCCCAGGCTGGATGG - Intergenic
1181308564 22:21931056-21931078 CCTGAAGTTCCCAGGCTGGGTGG + Intronic
1181672163 22:24430755-24430777 TCTGACCATCCCAGGCTAGAAGG - Intronic
1182419689 22:30242904-30242926 CCTGGCCATCCCAGGCTGCAGGG + Exonic
1182425247 22:30268137-30268159 CCTGAGCTGCTCCAGCTGGAGGG + Intergenic
1184004280 22:41697242-41697264 CCTGGCCTTTTCAGGCTGGATGG - Exonic
949951221 3:9230360-9230382 CCTGACATTCTCAAACTGGATGG + Intronic
950465525 3:13151115-13151137 ACTTCCCTTCCCACGCTGGAAGG + Intergenic
952482120 3:33772310-33772332 CCTCAGCTTCCCAAGCAGGGAGG - Intergenic
953318433 3:41950200-41950222 CCTCACCTTCCCAAGCAGCTGGG + Intronic
954116130 3:48467737-48467759 CCTCACTTTCCCTAGCAGGATGG + Intergenic
954683483 3:52358390-52358412 CTGGGCCTTCCCAGGCTGGATGG - Intronic
954949074 3:54453105-54453127 CCTCAGCTTCCCAAGCTGCTGGG + Intronic
955840918 3:63111824-63111846 CCTGGGCTTCACAAACTGGAAGG + Intergenic
956084756 3:65597573-65597595 TCTGGCCCTCCCAAGCTGGCCGG + Intronic
956900407 3:73709504-73709526 CCTCAGCTTGCCAAGCAGGAGGG + Intergenic
957169360 3:76718046-76718068 CATAACCTGCCCAAACTGGATGG + Intronic
957426913 3:80051283-80051305 CCTGACCCTTCCAAGTTGGTGGG + Intergenic
958950508 3:100410925-100410947 CCTGACCCACCAAAACTGGAAGG - Intronic
959607425 3:108257633-108257655 ATTGACCTTCACAAGCTGGTAGG - Intergenic
968650981 4:1760201-1760223 CCTGAGCTCCCGGAGCTGGAGGG - Intergenic
968683696 4:1940821-1940843 CCTGACCTTCCTGCACTGGAAGG - Intronic
972460301 4:39295681-39295703 TCCCACCTTCCCAAGCTGGCTGG - Exonic
973817864 4:54634638-54634660 CCTGGCATACCCATGCTGGATGG + Intergenic
975831180 4:78370632-78370654 CCTGACCTTATCAAGCTTGGAGG - Intronic
975875142 4:78827584-78827606 AGTGACCTTCCCAATCTGGAAGG + Intronic
977509091 4:97938647-97938669 GCAGAGCTTCCCAGGCTGGATGG + Intronic
978903041 4:113975866-113975888 CCGGACCTACCAAAGCTGAAGGG + Intronic
980738116 4:136917463-136917485 CCTGACCCTTCCAAGGTGGTAGG + Intergenic
982573055 4:157075003-157075025 CCTTAGCCTCCCAAGCTGGGGGG - Intergenic
982706338 4:158713929-158713951 CCTCACCTTCCCAAGTAGCAGGG - Intronic
982742718 4:159074516-159074538 CCAGAACTTCCCAAATTGGAGGG - Intergenic
983849289 4:172560380-172560402 CCTTACCTTCCCAAGTAGGTGGG - Intronic
984864720 4:184271861-184271883 CCTGGCTTTCCCATGCTGGAAGG + Intergenic
985659255 5:1147845-1147867 CCTCAGCTTCCCAAGCAGGTGGG + Intergenic
985821448 5:2163517-2163539 CCTGCCCTTCCTAAGCTGCTGGG - Intergenic
987603906 5:20108193-20108215 CCTCAGCTTCCCAAGCAGGTGGG + Intronic
988087138 5:26486783-26486805 CCTTACATTCCTAAGCTGCAGGG - Intergenic
991268112 5:64746877-64746899 CCTGACCTTATAAAGCTGGCTGG - Intronic
992879575 5:81093525-81093547 CCTCAGCTTCCCAAGCTGCTGGG + Intronic
999180120 5:149664269-149664291 CCTGGCCTAGCCTAGCTGGAAGG + Intergenic
999289976 5:150418112-150418134 CCTGAACTTCCCAGGCTCAAGGG + Intergenic
1001100327 5:168808950-168808972 CCTGACATTTCCAAACAGGAAGG - Intronic
1001521039 5:172393511-172393533 TCTTTCCTTCCCAATCTGGATGG + Intronic
1003264313 6:4552075-4552097 CTTTGCCCTCCCAAGCTGGAAGG + Intergenic
1003425010 6:5993111-5993133 CCTGACCTTCCAGAGCAGCAAGG + Intergenic
1003534072 6:6960797-6960819 CCTGACCTTCCACAGCTTGAGGG + Intergenic
1004802374 6:19163911-19163933 CCTGACCATCCCCAGCTCAAGGG + Intergenic
1005339579 6:24830829-24830851 CCTGAGCTTCCCAAGTAGCAGGG + Intronic
1006314153 6:33280297-33280319 CCTGACCTTCTCCAGCAGGGGGG + Intronic
1006573175 6:35022131-35022153 CCTGACTTTCTCAGGCTGGGTGG - Intronic
1007196522 6:40066322-40066344 CCTCACCTTCCCAAGGTGGGTGG - Intergenic
1007342586 6:41201013-41201035 CCTGACACTGCCCAGCTGGATGG - Exonic
1007574222 6:42914636-42914658 CCTCACCTTCCCAAGCAGCTGGG - Intergenic
1010642244 6:78342776-78342798 CCTGCCCTTTCCAAGGTGGAAGG - Intergenic
1011549601 6:88518275-88518297 CATGACTTTCCAAAGCTGGTTGG + Intergenic
1011603874 6:89083089-89083111 CCTCCCCTTCCCAGGCTGAAGGG + Intronic
1012169664 6:96002428-96002450 CCTGCCCCTCCCAAGTTGGCAGG - Intergenic
1013111291 6:107067446-107067468 CCTGACATTCCCAGTCGGGAGGG + Exonic
1013414580 6:109913322-109913344 CATGTCTTTCCCCAGCTGGAGGG + Intergenic
1014222477 6:118811715-118811737 CCTCAGCTTCCCAAACTGCAGGG + Intergenic
1015786485 6:136924087-136924109 CTGGACCTTCCCGGGCTGGAAGG + Exonic
1017373320 6:153737928-153737950 CTTGACTGTCCCACGCTGGAAGG - Intergenic
1018577953 6:165279176-165279198 CCTTAGCTTCCCAAGCTGCTGGG - Intergenic
1019182926 6:170203125-170203147 CCTGGTCTGCACAAGCTGGAAGG + Intergenic
1019883601 7:3884787-3884809 CTTGTCCTTCACAAGTTGGAAGG - Intronic
1019884503 7:3892380-3892402 CCTGCTCTTCTCATGCTGGAGGG + Intronic
1020445288 7:8261867-8261889 CCAGACCTTCCCAGGCCGGAGGG + Intronic
1020761114 7:12269324-12269346 CCTGCCCCTTCCAAGCTGGCAGG + Intergenic
1028213268 7:88101282-88101304 CATGAGCTTCCCAAACTGCATGG + Intronic
1029128920 7:98315203-98315225 CCTCAACTTCCCAGGCTGAAGGG + Intronic
1029199462 7:98828979-98829001 CCTCAACTTCCCAAGCTCAAGGG - Intergenic
1029626134 7:101721357-101721379 ACAGACCGTCCCCAGCTGGAAGG + Intergenic
1029820662 7:103143475-103143497 CCTGGCCATCCCTAGCTAGAAGG - Intronic
1029932017 7:104382370-104382392 CCTCACCCTCCCAAGCGGGTGGG - Intronic
1030007322 7:105132304-105132326 CCTCACCTTTCCAGACTGGAAGG - Intronic
1030192731 7:106825546-106825568 CCTCACCTTCCCAAGGTGCTGGG + Intergenic
1032183973 7:129707242-129707264 CCTGAGCCTCCCAAGGTGCAGGG + Intronic
1035142989 7:156782793-156782815 CCTCAGCTTCCCAAAATGGAGGG + Intronic
1035738828 8:1909946-1909968 CATGAACTTCCCAAGGTGAAAGG + Intronic
1037401121 8:18496304-18496326 ACTGACCTACCCAAGTTGCAGGG - Intergenic
1037850790 8:22326149-22326171 CCTCGCCTTCCCAGCCTGGAAGG + Intronic
1038844565 8:31216748-31216770 CTTTTCCTTCTCAAGCTGGAGGG + Intergenic
1039288419 8:36067885-36067907 CCTGAACATCCCTAGCAGGAAGG - Intergenic
1040558447 8:48501668-48501690 CATGACCTTCCCCAGCCGGTCGG - Intergenic
1041924098 8:63218295-63218317 CCTTACCCTCCCAAGGTGCAGGG + Intergenic
1042825111 8:72972155-72972177 CCTCAGCCTCCCAAACTGGAAGG - Intergenic
1047027903 8:120844657-120844679 CTTGACCTCCCCAGGCTCGAGGG + Intergenic
1047953251 8:129953240-129953262 CCTGACCTTCCCAAGCTGGAAGG - Intronic
1048250413 8:132862453-132862475 CCTGACCCTCCCAGGCAGGGTGG - Intergenic
1049432203 8:142570358-142570380 CCTGACCCTCACCAGCTGGCTGG + Intergenic
1049940859 9:544941-544963 CCTCACATACCCAAGCTGGAGGG - Intronic
1051869558 9:21721576-21721598 CCTGAGCTAGCCAAGCAGGACGG + Intergenic
1053357060 9:37455248-37455270 TCTGACCATCCCCAGCTGAATGG - Intronic
1054722064 9:68614198-68614220 ACTTATCTTCCCAAACTGGAAGG + Intergenic
1056780766 9:89548682-89548704 CCTCAGCTTCCCAAGGTGCAGGG - Intergenic
1056841948 9:90004854-90004876 CCCTGCCTTCCCCAGCTGGAAGG + Intergenic
1057935458 9:99234825-99234847 CCTGAGATGCCCTAGCTGGAAGG + Intergenic
1059330693 9:113533719-113533741 GATGGCCTTTCCAAGCTGGAAGG + Intronic
1060113391 9:120922547-120922569 CCTGGCCCTCCCAAGCTGGAAGG - Intronic
1060961447 9:127683568-127683590 CCTGAGCTGCCCCAGCTGGGAGG + Intronic
1061117419 9:128623169-128623191 CCTGAGCTTCCCTAGCTAGCTGG + Intronic
1061541655 9:131280723-131280745 ACTGACCCTGCCAAGCTGCAGGG + Intergenic
1186959559 X:14721002-14721024 CCTTAGCCTCCCAAGGTGGACGG - Intronic
1188006150 X:25016858-25016880 CCTGACCTCTCCAGGGTGGAAGG + Intergenic
1188903348 X:35761992-35762014 GATGATCTACCCAAGCTGGATGG - Intergenic
1188972953 X:36639498-36639520 ACTGCCCTTTGCAAGCTGGAAGG - Intergenic
1189275166 X:39780123-39780145 CATGACCATCCCTAGCTGCAAGG + Intergenic
1191674069 X:63776794-63776816 TCTCACTTTCCCAAGCTGTACGG + Intronic
1192107948 X:68334146-68334168 CCTGAGCCTCCCAAGGTGCAGGG + Intronic
1192381185 X:70618317-70618339 CATCACCTTCCAAACCTGGAAGG - Intronic
1196285469 X:113873788-113873810 TCTGACCTACCTAAGCTGGCTGG - Intergenic
1199758187 X:150884426-150884448 CCTCAGCTTCCCAAACTGCAGGG - Intronic
1200986149 Y:9304820-9304842 CCTGAGCTTCCTCAGCTAGATGG + Intergenic
1202119412 Y:21508502-21508524 CCTGACCTTCTTCAGCTGGTTGG - Intergenic
1202121864 Y:21532042-21532064 CCTGACCTTCTTCAGCTGGTTGG - Intronic
1202157142 Y:21897340-21897362 CCTGACCTTCTTCAGCTGGTTGG + Intronic
1202159588 Y:21920881-21920903 CCTGACCTTCTTCAGCTGGTTGG + Intergenic
1202186033 Y:22185796-22185818 CCTGACCTTCTTCAGCTGGTTGG + Intergenic
1202205326 Y:22400600-22400622 CCTGACCTTCTTCAGCTGGTTGG - Intronic