ID: 1047953276

View in Genome Browser
Species Human (GRCh38)
Location 8:129953362-129953384
Sequence CTCAAGTACAAGTTGGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047953276_1047953280 18 Left 1047953276 8:129953362-129953384 CCTGGTCCCAACTTGTACTTGAG 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1047953280 8:129953403-129953425 TGCCTAGAGCCCCCAGGTATTGG No data
1047953276_1047953279 12 Left 1047953276 8:129953362-129953384 CCTGGTCCCAACTTGTACTTGAG 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1047953279 8:129953397-129953419 TCTTAATGCCTAGAGCCCCCAGG No data
1047953276_1047953282 23 Left 1047953276 8:129953362-129953384 CCTGGTCCCAACTTGTACTTGAG 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1047953282 8:129953408-129953430 AGAGCCCCCAGGTATTGGCCTGG No data
1047953276_1047953283 24 Left 1047953276 8:129953362-129953384 CCTGGTCCCAACTTGTACTTGAG 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1047953283 8:129953409-129953431 GAGCCCCCAGGTATTGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047953276 Original CRISPR CTCAAGTACAAGTTGGGACC AGG (reversed) Intronic
903264977 1:22152643-22152665 CTAAAGAGCAAGTTGAGACCAGG - Intergenic
905023778 1:34836289-34836311 CCCCAGTAAAAGTTGGGACCAGG - Intronic
905305281 1:37013659-37013681 ATCAAGCACATGTTTGGACCAGG + Intronic
908979621 1:69939740-69939762 GTCAAGTACCAGTTGGGAGCTGG - Intronic
910677549 1:89830272-89830294 ATAAAGTACAAATTGGGAACTGG + Intronic
912394092 1:109326347-109326369 CTTAAGTACAAGTTCTGAGCTGG - Intronic
914989217 1:152483903-152483925 CTCCAGTACATGATGGGACAAGG - Intergenic
917294640 1:173505895-173505917 CTCAAGTACAAGTAGGCACAGGG + Intronic
920055020 1:203185172-203185194 CTCAAGAACAGGTTGGGCCAGGG - Exonic
920251586 1:204625703-204625725 TTCCATGACAAGTTGGGACCAGG + Intronic
923506773 1:234611124-234611146 CTCGAGTCCAAGTTCGGGCCCGG - Intergenic
1063145783 10:3293968-3293990 CACGAGGACAAGTGGGGACCTGG + Intergenic
1063202935 10:3802214-3802236 CTCAAGGACAATATGTGACCCGG - Intergenic
1065553314 10:26890428-26890450 CTCAACCACAAGCTGGGCCCTGG + Intergenic
1065599808 10:27356888-27356910 CTCAACCACAAGCTGGGCCCTGG - Intergenic
1070330054 10:75409914-75409936 CTCACGTGCAAGTTTGGGCCTGG - Intergenic
1074467456 10:113696136-113696158 TTCTAGTAACAGTTGGGACCAGG + Intronic
1075298710 10:121300905-121300927 GTCAAGTTCAAGTAGGGCCCGGG + Intergenic
1084535327 11:69753078-69753100 CTGAAGTACAAATCAGGACCTGG + Intergenic
1085829640 11:79885624-79885646 CTCAATTACCACTTGGGATCAGG + Intergenic
1100719458 12:97342345-97342367 CTCATGTAAACGTTGGGCCCAGG + Intergenic
1104809797 12:131613201-131613223 CTCAGGGACAAGCTGGGCCCTGG + Intergenic
1108869230 13:54961888-54961910 CTCAAGAAGAAGCTGGGAGCAGG + Intergenic
1114201415 14:20524402-20524424 CCAAAGTACAAGTGGTGACCTGG + Intergenic
1114564697 14:23621843-23621865 CTCAAGTCCAAGGTCAGACCTGG + Intergenic
1115510191 14:34130897-34130919 CTCAAGTAAAAGTTTAAACCAGG + Intronic
1130626220 15:85518271-85518293 CTCAAGTAATAGTAGGTACCTGG + Intronic
1131006367 15:88982045-88982067 CTCAAGAACAAAGTGGGGCCAGG + Intergenic
1133093700 16:3426352-3426374 CTCAAGGAGAAGCTGGGAACTGG + Intronic
1133303723 16:4797703-4797725 CTCAAGGACAAGGTGGGCCCGGG - Exonic
1138121190 16:54402145-54402167 GTCAAGTAAAGGTGGGGACCTGG + Intergenic
1139399226 16:66667027-66667049 CTAAAATAAAAGTTGGGGCCGGG + Intronic
1142894151 17:2963737-2963759 CTCAAGTACCAGTGGGTACCAGG + Intronic
1145070459 17:19801276-19801298 CTCAAAAAGAAGTTGGGGCCGGG + Intronic
1152070729 17:78132487-78132509 CTCAAGTTCAGGGTGGGGCCTGG - Exonic
1153264678 18:3258451-3258473 ATCAAGTAAAATTTGGGGCCTGG - Intergenic
1158130474 18:54147451-54147473 CTTAAGTAAAAGATGGGATCTGG + Intergenic
1159065781 18:63566796-63566818 GACAAGTACAAATTGGGACTTGG - Exonic
1159725424 18:71951966-71951988 CTCAGGAAAAAGTTGGGCCCAGG + Intergenic
1164877460 19:31701407-31701429 GTCAAGTACAAGGAGGGCCCGGG + Intergenic
1167794477 19:51700590-51700612 CTCCAGTTCAAGTTGGATCCTGG + Intergenic
1168356251 19:55701890-55701912 CTGAAGAACCAGTTAGGACCAGG + Intronic
925986779 2:9222830-9222852 CCCAAGGAAAAGGTGGGACCAGG - Intronic
931925297 2:67065849-67065871 TTGAAGCACAACTTGGGACCTGG - Intergenic
933757734 2:85653312-85653334 CTCAAGAACAAGCAGGGGCCAGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
939275645 2:139993125-139993147 CTCAAGCACACGTGGGGTCCTGG - Intergenic
947637003 2:231685247-231685269 CTCAAGCACAGGTTGGAACCAGG - Intergenic
1169066893 20:2698783-2698805 CTCAAAGACAAATTAGGACCAGG + Intronic
1169828214 20:9792819-9792841 ATCAAGTGGAAGTTGGCACCTGG + Intronic
1173540979 20:43850782-43850804 GAAAAGTACAAGTTGAGACCAGG - Intergenic
1174184708 20:48698323-48698345 CTCATCTAAAAGTTGGGAGCAGG + Intronic
1174450630 20:50617915-50617937 GTCAAGTAAAAGTTGAAACCAGG - Intronic
1179507322 21:41850436-41850458 CTCAAGAACAAGTTAAGGCCAGG + Intronic
1182393896 22:30021507-30021529 CTCAAGTACAAGTGTGAGCCTGG + Intronic
1184543388 22:45146102-45146124 ATAAAGGACATGTTGGGACCAGG - Intergenic
951498854 3:23361667-23361689 CTCAAGGAAAGGTTGGGAGCAGG + Intronic
954447166 3:50553000-50553022 CTCAAGTCCAAGTGGGGACTAGG + Intergenic
967568895 3:191004049-191004071 CGCAAGTACAATTTTGGACCAGG - Intergenic
967597344 3:191342540-191342562 CTTAAGTACAAGTTTACACCAGG - Intronic
983752447 4:171292614-171292636 CTGATGTTCAAGTTGTGACCAGG + Intergenic
986474111 5:8108084-8108106 ATCAATTAGAAGTTAGGACCTGG + Intergenic
986965362 5:13263960-13263982 CTCAAGTACAATGTGGTACATGG - Intergenic
994935606 5:106249512-106249534 CTCATGTACAATTTGGGAAGGGG - Intergenic
1002044396 5:176533774-176533796 CTCAACTCAAAGTTGGGACGAGG + Intronic
1004822590 6:19383678-19383700 ATCAAGTAGAAGTTGGAAACTGG - Intergenic
1005557951 6:27007378-27007400 CTCAAGTAGAAGCTGTGACCTGG - Intergenic
1007134336 6:39507126-39507148 CACAAGTACAAGTGGCAACCTGG + Intronic
1007696947 6:43740121-43740143 CTCAAATCCAAGATGTGACCTGG + Intergenic
1011346486 6:86374712-86374734 CACAAGTCAAAGTTGGGACCAGG - Intergenic
1014514642 6:122364631-122364653 CTGGAGTTCAAGTTTGGACCTGG + Intergenic
1016564860 6:145441222-145441244 CCAAAGTACAAGTTGGGCCATGG - Intergenic
1019012233 6:168851145-168851167 CTCAAGTAGTTGTTGGGAGCAGG + Intergenic
1022802151 7:33786967-33786989 TTCAAGTGGAAATTGGGACCAGG - Intergenic
1027199329 7:76053217-76053239 CACAAGTGCCATTTGGGACCAGG + Intronic
1033129700 7:138735293-138735315 CTCAAGTACAGGTGGGGACAGGG - Intronic
1036635773 8:10548681-10548703 CCCAGGCACAAGGTGGGACCCGG + Intronic
1039106193 8:33992501-33992523 ATCAAGTAAAAGCTGGGAGCTGG + Intergenic
1041343811 8:56874334-56874356 CTGAAAAACAAGATGGGACCTGG - Intergenic
1042591207 8:70401583-70401605 TTCAAGTACACTTTGGGAACTGG + Intronic
1047953276 8:129953362-129953384 CTCAAGTACAAGTTGGGACCAGG - Intronic
1049656683 8:143802180-143802202 CTCAAGGACAGGAGGGGACCCGG + Intronic
1050512202 9:6407865-6407887 CTCAGGTAGGAGTGGGGACCTGG - Intergenic
1051706745 9:19888883-19888905 CACAAGCACAAATTGGAACCTGG + Intergenic
1056629698 9:88282977-88282999 CTCTAATACTAGTTGAGACCTGG - Intergenic
1059809552 9:117840566-117840588 CTGAAGTGAAAGATGGGACCCGG - Intergenic
1189114628 X:38329924-38329946 CTAAAGTACAGGGTGGGAGCAGG - Intronic
1192795321 X:74420974-74420996 CTCAAGTCCAAGGAGGGACATGG + Intergenic
1193832244 X:86303561-86303583 CTCAAGTATCAGTTGGGAAGTGG + Intronic
1194395043 X:93372954-93372976 CTCAAGGAGAATTTGGGAGCTGG + Intergenic
1194684298 X:96893683-96893705 CTCAAGTACACCTTGGTAGCAGG - Intronic
1196865703 X:120068753-120068775 CTCAAGTACAGGTTGCAAACTGG + Intergenic