ID: 1047953566

View in Genome Browser
Species Human (GRCh38)
Location 8:129955913-129955935
Sequence TGCATCCATCGGGATGGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047953557_1047953566 15 Left 1047953557 8:129955875-129955897 CCAATGCCTGAATCCACTGTGGT 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1047953566 8:129955913-129955935 TGCATCCATCGGGATGGGATAGG No data
1047953558_1047953566 9 Left 1047953558 8:129955881-129955903 CCTGAATCCACTGTGGTTATTAA 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1047953566 8:129955913-129955935 TGCATCCATCGGGATGGGATAGG No data
1047953560_1047953566 2 Left 1047953560 8:129955888-129955910 CCACTGTGGTTATTAAAAGGATG 0: 1
1: 0
2: 1
3: 21
4: 193
Right 1047953566 8:129955913-129955935 TGCATCCATCGGGATGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047953566 Original CRISPR TGCATCCATCGGGATGGGAT AGG Intronic
No off target data available for this crispr