ID: 1047954526

View in Genome Browser
Species Human (GRCh38)
Location 8:129963338-129963360
Sequence CACTTCGGATTTCATTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047954526_1047954529 0 Left 1047954526 8:129963338-129963360 CCTGACTAATGAAATCCGAAGTG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1047954529 8:129963361-129963383 CTGTGGTGTATGCTGCATGCTGG No data
1047954526_1047954530 21 Left 1047954526 8:129963338-129963360 CCTGACTAATGAAATCCGAAGTG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1047954530 8:129963382-129963404 GGCTATACACAGATGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047954526 Original CRISPR CACTTCGGATTTCATTAGTC AGG (reversed) Intronic
900850908 1:5142317-5142339 CATCTCTGATTTCATTAGTTGGG + Intergenic
910123840 1:83819057-83819079 CACTTGAGATTTCATCAGTTTGG - Intergenic
915446461 1:155977451-155977473 CACCTAGCATTTCATGAGTCTGG - Intronic
916142817 1:161713908-161713930 CACCTAGGGTTTCATTAGGCTGG - Exonic
919938818 1:202272506-202272528 CACTTAGGATATCATGAGCCAGG + Intronic
1065875937 10:29996993-29997015 AAATTCTGATTTCATTGGTCTGG + Intergenic
1068529460 10:58168334-58168356 CAGATCGCATCTCATTAGTCTGG + Intergenic
1071381203 10:85061923-85061945 AACTTTGATTTTCATTAGTCTGG - Intergenic
1074633967 10:115292211-115292233 CACTTCTGATTTTATTTATCTGG + Intronic
1092275399 12:7057145-7057167 CACCTCAAATTTCATTGGTCAGG - Intronic
1100704825 12:97188970-97188992 CACTGGGGATTTCAAAAGTCGGG + Intergenic
1104637852 12:130449238-130449260 CACTTGGGAATTCATCAGCCAGG - Intronic
1115288848 14:31747669-31747691 CACTTCTGATTTTATTTATCTGG + Intronic
1122285175 14:100647036-100647058 CTCTCCGGATTTCATTTGTAAGG - Intergenic
1125005413 15:34811273-34811295 CAATTCTGATTTAATTGGTCTGG + Intergenic
1125029537 15:35062321-35062343 CAATTCAGATTCTATTAGTCTGG + Intergenic
1125611835 15:40976617-40976639 CACTTGGGATTTCATTGTTCTGG - Intergenic
1127647973 15:60976401-60976423 CACTTTGGAATTATTTAGTCTGG - Intronic
1130833726 15:87629239-87629261 AACTTTGGATTTAATAAGTCTGG - Intergenic
1136097998 16:27972752-27972774 CGATTCTGATTTCATTGGTCAGG + Intronic
1143230215 17:5347625-5347647 CAATTTTGATTTCACTAGTCTGG + Intronic
1156729479 18:40173947-40173969 CAATTTGCATTTCATTAATCTGG + Intergenic
1157516194 18:48313408-48313430 CAATTCGGATCTAATTTGTCTGG - Intronic
1158226422 18:55206002-55206024 TCCTTCTGATTTCATTTGTCTGG - Intergenic
1160368645 18:78351663-78351685 CACATGGTATTTCATTAGCCCGG - Intergenic
1165580438 19:36858130-36858152 CAATTCTGATTTAATTGGTCTGG + Intronic
926007046 2:9380609-9380631 CACTGTGGATTTCATTAACCAGG + Intronic
929148360 2:38726600-38726622 TACTTCGGCTTGCATTTGTCTGG - Intronic
933110980 2:78399663-78399685 CTCTACGGATGTCATTAGACAGG + Intergenic
937468833 2:122158023-122158045 AAACTCTGATTTCATTAGTCAGG + Intergenic
939846695 2:147255240-147255262 CAATTCTGATTTCATAGGTCAGG - Intergenic
944141206 2:196459179-196459201 CACTTCGGATCAGATTAGACAGG + Intronic
1169450139 20:5703783-5703805 CACTGACGTTTTCATTAGTCTGG + Intergenic
1173969552 20:47141399-47141421 CAATTCTGATTTTATTGGTCTGG + Intronic
1182817925 22:33183486-33183508 CACTGCTGATTTCATTACTTTGG - Intronic
949193711 3:1280981-1281003 CATTTCAAATTTCTTTAGTCAGG + Intronic
952346545 3:32492905-32492927 CACTTCAGATAACATCAGTCTGG - Intronic
958149568 3:89672060-89672082 CACTTTGGTTTTCATTTGTGTGG - Intergenic
966952707 3:184837238-184837260 GACTTCTGATTCCATTATTCAGG + Intronic
970966345 4:21932707-21932729 GACTTAGGATTTCACTGGTCTGG - Intronic
974217983 4:58925520-58925542 TACTTCAGATTCTATTAGTCTGG - Intergenic
975867166 4:78736043-78736065 TACTTCTGATTCAATTAGTCTGG - Intergenic
977276383 4:94982530-94982552 CAATTCTGATTTCATTGGTTTGG + Intronic
977628484 4:99215452-99215474 CAATTGTGATTTAATTAGTCTGG - Intronic
978195314 4:105965231-105965253 CACTTCTGATTTCATAATTCTGG - Intronic
983375338 4:166920326-166920348 AATTTCAGATTTCATTAGCCAGG - Intronic
984995965 4:185430167-185430189 CACTTAGCATTTCATTTCTCAGG - Intronic
986714047 5:10509733-10509755 CTGTTCTGATTTCATTAGGCGGG - Intronic
987240533 5:15994059-15994081 AGATTCTGATTTCATTAGTCTGG - Intergenic
990633306 5:57694927-57694949 AGCTTCGGATTTAATTAATCTGG + Intergenic
992202470 5:74397983-74398005 TACTTCGGGTTTCATTATTAAGG - Intergenic
992576388 5:78118134-78118156 AAATTCTGATTTAATTAGTCTGG + Intronic
993517961 5:88861292-88861314 CAATCCTGATTTCATCAGTCTGG - Intronic
995495031 5:112732685-112732707 CCCTTGGGATTTTAATAGTCAGG + Intronic
997129927 5:131266259-131266281 GACTTTGGATCACATTAGTCTGG - Intronic
1001316963 5:170650206-170650228 CATATCTGATTTTATTAGTCTGG + Intronic
1003852869 6:10242721-10242743 CCATTCTGATTTCATTAGTTTGG - Intergenic
1007752696 6:44080032-44080054 CAATTTTGATTTCCTTAGTCAGG - Intergenic
1013628252 6:111959007-111959029 CACTTCTGATTTAATTGGCCTGG + Intergenic
1014751765 6:125264980-125265002 AAATTCTGATTTCATTAGTTTGG + Intronic
1015099941 6:129465321-129465343 CACTTTGGATTTCATGATTAAGG - Intronic
1016382156 6:143495703-143495725 CACTTTAGATCACATTAGTCAGG + Exonic
1017119801 6:151013555-151013577 AACTTCTGCTTTCATTGGTCTGG + Intronic
1020094234 7:5359397-5359419 CTCGTCGGACTTCATCAGTCAGG - Exonic
1022057047 7:26747924-26747946 GATTTCAGATTTCATTATTCTGG - Intronic
1028975752 7:96911735-96911757 CAGTTGGTATTTGATTAGTCAGG + Intergenic
1029428431 7:100512857-100512879 CAGTGGGGATTTCATTAGGCTGG - Intergenic
1030162273 7:106521134-106521156 CAGTTTGGTTTTCACTAGTCAGG + Intergenic
1031857802 7:126943037-126943059 CACTTGGGAGCTTATTAGTCAGG - Intronic
1032693360 7:134311710-134311732 CACTTCTAATTTGATTAGTCTGG + Intronic
1042417062 8:68532803-68532825 CACTTGGGAATTCCTTAGTGAGG + Intronic
1042974220 8:74447425-74447447 CACTTCAGATTTCAGTTTTCCGG - Intronic
1044076647 8:87830789-87830811 AACTTTTGATTTAATTAGTCTGG + Intergenic
1047065084 8:121272931-121272953 CATTTCAGATTTAATTTGTCTGG + Intergenic
1047469261 8:125152391-125152413 AGATTCTGATTTCATTAGTCTGG + Intronic
1047954526 8:129963338-129963360 CACTTCGGATTTCATTAGTCAGG - Intronic
1048447276 8:134500971-134500993 CACTGCAGAGTTCATTAGGCAGG + Intronic
1048632039 8:136254299-136254321 AACTTTGGATTTGATTAGTAAGG - Intergenic
1050132046 9:2422928-2422950 CACTTCGGATTCCCATAGTGCGG + Intergenic
1056455457 9:86755257-86755279 CACTTTGGAATTCAGCAGTCTGG - Intergenic
1060311477 9:122466494-122466516 CACTTCTGATTTGGTTAATCTGG + Intergenic
1187126407 X:16458113-16458135 GGATTCTGATTTCATTAGTCTGG + Intergenic
1187239278 X:17498020-17498042 TGATTCGGATTTAATTAGTCTGG - Intronic
1188420941 X:29990217-29990239 CACTTCTGATTTTATTTGTTTGG + Intergenic
1194866245 X:99071762-99071784 CACTTGGAATTACATCAGTCTGG - Intergenic
1195968786 X:110452737-110452759 CACTTTGGCTCTCATTAGTGAGG - Exonic
1197215119 X:123860071-123860093 CACTTCGGGTTTCACGACTCCGG + Exonic
1197623251 X:128775512-128775534 CACTTTTATTTTCATTAGTCTGG + Intergenic
1199078920 X:143555011-143555033 CACTGGGAATTTCATTAGGCTGG - Intergenic