ID: 1047954528

View in Genome Browser
Species Human (GRCh38)
Location 8:129963353-129963375
Sequence CAGCATACACCACAGCACTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047954528_1047954530 6 Left 1047954528 8:129963353-129963375 CCGAAGTGCTGTGGTGTATGCTG 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1047954530 8:129963382-129963404 GGCTATACACAGATGAAGCAAGG No data
1047954528_1047954531 28 Left 1047954528 8:129963353-129963375 CCGAAGTGCTGTGGTGTATGCTG 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1047954531 8:129963404-129963426 GTGATCCATACCATCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047954528 Original CRISPR CAGCATACACCACAGCACTT CGG (reversed) Intronic
901826293 1:11863846-11863868 CAGCAGTAATCACAGCACTTTGG - Intergenic
902158753 1:14512138-14512160 CACAGTAGACCACAGCACTTAGG + Intergenic
903176969 1:21587209-21587231 CTGCCCACACCACAGCACATGGG - Intergenic
903804453 1:25994746-25994768 CTGCATAGAGAACAGCACTTGGG + Intronic
916820473 1:168393348-168393370 CACCATGCATCACAGCACATAGG - Intergenic
917848060 1:179039184-179039206 CTGCAGACAGCACAGCACTGAGG - Intronic
920828531 1:209445231-209445253 CAGCACCCACCACAGCAGCTGGG + Intergenic
923233603 1:232011274-232011296 CAGCAGCCACCACAGGACCTAGG - Intronic
1063346105 10:5313703-5313725 CAGCATCCAACAGACCACTTGGG + Intergenic
1067221720 10:44348674-44348696 GAGCATTCACCACAGCCCCTGGG - Intergenic
1069238289 10:66105946-66105968 CAGCAAATATCCCAGCACTTTGG + Intronic
1071057127 10:81524839-81524861 CAGCATTCACCACTGGCCTTTGG + Intergenic
1071523080 10:86342739-86342761 CAGCATACCCCTCAGCATTGAGG + Intronic
1071810092 10:89170037-89170059 CAGCATATACCACAGTGCCTGGG - Intergenic
1072265927 10:93727858-93727880 CAGCAGACAACAGAGCCCTTTGG - Intergenic
1072357230 10:94623799-94623821 GGGCATAAACCACAGCACTCAGG - Intergenic
1076480317 10:130780623-130780645 CAGCATGCGCCGCAGGACTTTGG - Intergenic
1077652593 11:3986937-3986959 AGGCATACACCTCAGCAGTTTGG + Intronic
1078436960 11:11333308-11333330 CAGAATACAGCCTAGCACTTTGG - Intronic
1079360937 11:19769881-19769903 AAACATAGACCACAGCCCTTTGG + Intronic
1079469557 11:20765399-20765421 CACCAGACACCACAGCACAGTGG + Intronic
1081154606 11:39674617-39674639 CAGCATACATCAAAGATCTTGGG + Intergenic
1081580883 11:44350823-44350845 CAGCATAATCCCCGGCACTTAGG + Intergenic
1083052836 11:59792356-59792378 CAGCCTACAGCACAGCATTCGGG - Intronic
1086205570 11:84254417-84254439 TAGAATTCTCCACAGCACTTGGG + Intronic
1090299202 11:125620086-125620108 AAGCATATACCACAGAACATTGG + Exonic
1095326325 12:40897819-40897841 CTTCATAAACCAAAGCACTTAGG + Intronic
1096727786 12:53578980-53579002 CCTCACACACAACAGCACTTTGG + Intronic
1099675799 12:85759221-85759243 CAGCTTATACCCCAGCACTTTGG + Intergenic
1100448880 12:94686235-94686257 CAGCATTAATCCCAGCACTTTGG + Intergenic
1100855971 12:98757500-98757522 CAGCATTCATCACAGCTCCTGGG - Intronic
1101906543 12:108830903-108830925 CAGCTGTCACCCCAGCACTTTGG - Intronic
1103573125 12:121857913-121857935 CAGCCTCAACCACAGAACTTAGG + Intronic
1108643453 13:52404637-52404659 CAGAACACATCACATCACTTGGG + Intronic
1109650440 13:65317012-65317034 CAGCGAACATCACACCACTTGGG + Intergenic
1110190710 13:72726929-72726951 CAGGCGACACCATAGCACTTGGG + Intronic
1112597214 13:100818491-100818513 CAGCATTCTCCAAAGCTCTTGGG + Intergenic
1112699369 13:101987867-101987889 TAGTATACACCTCTGCACTTAGG - Intronic
1114675886 14:24440211-24440233 CAGCTTGCACCACAGCGCTGGGG + Exonic
1115344345 14:32326527-32326549 CACCATACACCAGGGCCCTTCGG + Intergenic
1118368661 14:65117143-65117165 CAGGACACAGCACAGCACTTGGG - Intergenic
1120171113 14:81247940-81247962 CAGCAGCCACCCCAGCACTGGGG - Intergenic
1120948131 14:90016958-90016980 CAACACAAACCACAGCACTTGGG + Intronic
1121134021 14:91478476-91478498 CAGCCTTCACAGCAGCACTTTGG + Intronic
1121427038 14:93859780-93859802 CAGCTGACACCAGAGCACCTCGG + Intergenic
1124820072 15:33035998-33036020 CACCATACCCCACACCACCTCGG + Intronic
1125157248 15:36601922-36601944 CACCATACACCAAAACACTCAGG + Intronic
1132105851 15:99062104-99062126 CAACACCCAGCACAGCACTTGGG - Intergenic
1133329628 16:4964440-4964462 AAGCATGCACCACCACACTTAGG - Intronic
1135108841 16:19674454-19674476 CAGCACAAATCCCAGCACTTTGG - Intronic
1135936407 16:26784200-26784222 CAGCATTCAGCACAGTGCTTGGG - Intergenic
1138436118 16:57000990-57001012 CAGCATAGACCCCATCACTGGGG + Intronic
1138865235 16:60810389-60810411 CAGCATCCTCCACTTCACTTAGG + Intergenic
1141743360 16:85909223-85909245 TAGCCTTCACCACAGAACTTGGG + Intronic
1142298824 16:89244444-89244466 CAGCTCACTCCTCAGCACTTCGG + Intergenic
1143985107 17:10906558-10906580 CAGTATACAGCACAGCACTCAGG + Intergenic
1144031113 17:11324402-11324424 CAGCACAGGCCACAGCACTCAGG - Intronic
1146485252 17:33237492-33237514 AGGCATACACCACAACACTCAGG + Intronic
1146960881 17:36977214-36977236 CAGCATCCAACACATCACCTGGG - Intronic
1148473586 17:47911920-47911942 CAGCAGACTTCTCAGCACTTAGG + Intronic
1149312529 17:55408738-55408760 CAGCAATAATCACAGCACTTTGG + Intronic
1150460242 17:65344485-65344507 CTCCATACATCCCAGCACTTTGG - Intergenic
1151035626 17:70795499-70795521 CAGCAACAACCACATCACTTGGG + Intergenic
1151368616 17:73633020-73633042 CACCTGAAACCACAGCACTTTGG + Intronic
1152283616 17:79399775-79399797 CAGCAGACACCACAGACCCTCGG + Intronic
1155279131 18:24220189-24220211 CCGCCTACACCACAGCACAGTGG + Intronic
1159880020 18:73850204-73850226 CAGCACAGAACACAGCACTGTGG - Intergenic
1160473930 18:79166106-79166128 CTGCAGACATCTCAGCACTTAGG - Intronic
1167305129 19:48703724-48703746 CAGCAAACACCACATCACCGTGG - Exonic
1167633075 19:50637947-50637969 CAGCAACCAGCACAGCACGTAGG - Exonic
1167779467 19:51589292-51589314 CAGCAAACCCCACTGCACTGAGG - Exonic
929453685 2:42052009-42052031 CAACATACTCCACAGCAGCTAGG - Intronic
930196345 2:48514344-48514366 TAGCCTAAACCCCAGCACTTTGG - Intronic
932882467 2:75516650-75516672 GAGCAAACAGCACTGCACTTCGG - Intronic
934818719 2:97353468-97353490 CAGGCTACACCACAGTAATTTGG + Intergenic
935671247 2:105559029-105559051 CAGCATACACCACAGTTTTGGGG - Intergenic
936383942 2:112012165-112012187 CAGCAGACCCCACAGCATATGGG - Intronic
936670402 2:114649610-114649632 CAGGATCCATCCCAGCACTTTGG - Intronic
937118444 2:119426041-119426063 CAGGAAACACCCCACCACTTAGG - Intergenic
938536568 2:132253550-132253572 CAGCATGCACGACAGCACGATGG + Intronic
942666599 2:178325980-178326002 CAGTAGACACCACATCTCTTGGG + Intronic
944225798 2:197347588-197347610 CAGAATCCACCTCAGCTCTTAGG + Intergenic
945640442 2:212420851-212420873 CAGCACACATCACAGTGCTTGGG + Intronic
1168881496 20:1209955-1209977 CAATATACACCACAACACATGGG - Intergenic
1169638336 20:7720211-7720233 CTTCATACACCACTGCACTCGGG - Intergenic
1171365604 20:24621517-24621539 CAGCAGACACATCAGCACATGGG - Intronic
1171742751 20:28920819-28920841 AAGCACACACCACAACCCTTTGG + Intergenic
1173537256 20:43824963-43824985 CAGCAAAGAGCTCAGCACTTAGG - Intergenic
1176271465 20:64237212-64237234 CAGGCTTCCCCACAGCACTTTGG + Intronic
1179535833 21:42051261-42051283 CAATACACACCAAAGCACTTGGG - Intergenic
1180016477 21:45088758-45088780 CAGCAGACACCACGTCACCTGGG + Intronic
950805448 3:15599246-15599268 CAGCACCCAACACAGCACATGGG + Intronic
954668220 3:52271831-52271853 CATCAGTCATCACAGCACTTTGG + Intronic
954704322 3:52471102-52471124 CAGCACCCACCACAGCGCTTTGG - Intronic
954838061 3:53488082-53488104 CAGCATCCACCAGTACACTTTGG - Intergenic
958696720 3:97537479-97537501 CAGCACACACCACACCATATTGG - Intronic
961024495 3:123541885-123541907 AAGAATACATCCCAGCACTTTGG + Intronic
961673601 3:128551616-128551638 CAGCAAACACCACAGGACAGAGG + Intergenic
961906615 3:130269435-130269457 CTGCACACACCACACTACTTAGG + Intergenic
961933026 3:130554131-130554153 CACCATCCAACAAAGCACTTTGG - Intergenic
962964563 3:140341582-140341604 CTGCAAACACCCCAGCAGTTTGG + Intronic
967087233 3:186107123-186107145 CAGCATCCTCCGCAGCACTTTGG + Intronic
967688128 3:192441227-192441249 CAGCATTCATCACAGAAATTAGG + Intronic
968096191 3:195932406-195932428 CAGCACTCACCACAGGCCTTGGG + Intergenic
972770169 4:42190250-42190272 CAGCATTCACCTGAGCACCTGGG + Intergenic
973904076 4:55508850-55508872 CAGCAGAGACCCCAGCACTTTGG - Intronic
974099510 4:57401473-57401495 CAGTTTACATCCCAGCACTTTGG + Intergenic
974935251 4:68403760-68403782 CAGCACCCGCCTCAGCACTTTGG + Intergenic
979753078 4:124303527-124303549 CACCTTTCACCACAACACTTAGG - Intergenic
987106470 5:14644798-14644820 GAGCACACACCACAGCATTCAGG + Intergenic
988781894 5:34529869-34529891 CAATATACACCAAAGCACTTGGG - Intergenic
990617226 5:57520368-57520390 CAACCTCCCCCACAGCACTTTGG - Intergenic
993701052 5:91119883-91119905 CAGCAGAGACTGCAGCACTTTGG + Intronic
994685687 5:102948291-102948313 CAGCATATACCTCAATACTTTGG - Intronic
995648689 5:114343247-114343269 CAGAACAAACCACAGCCCTTTGG - Intergenic
996094067 5:119379732-119379754 AAGCATACACCACAACACCTGGG + Intronic
999286655 5:150398289-150398311 CAACATTGACCCCAGCACTTAGG + Intronic
1004102064 6:12623082-12623104 CAGAATACACCCAAGCACTGTGG - Intergenic
1007382387 6:41499204-41499226 CAGCACACACCACAACCCCTTGG + Intergenic
1008947627 6:57116289-57116311 TGGCTTACGCCACAGCACTTTGG + Intronic
1009014556 6:57883392-57883414 CCACATTCCCCACAGCACTTTGG - Intergenic
1009758707 6:67976321-67976343 CAGGATAAACTACAGCCCTTTGG + Intergenic
1012960594 6:105617537-105617559 CACAATACATCCCAGCACTTTGG - Intergenic
1013651381 6:112198527-112198549 CAGCAAAGACCACCGCAATTTGG + Intronic
1015316923 6:131827408-131827430 CAGCATCCACCACAGCCTGTAGG + Intronic
1016306709 6:142692652-142692674 CAGCATCCTCTACACCACTTGGG + Intergenic
1018427566 6:163697315-163697337 AAGCACACACCACAGCCCTTAGG - Intergenic
1020718242 7:11706265-11706287 CAGACAAGACCACAGCACTTGGG - Intronic
1023411546 7:39893465-39893487 CAGCCTTCATCCCAGCACTTTGG + Intergenic
1025224150 7:57142168-57142190 CAGGATTCAGCACAGCACTGAGG - Intergenic
1026303285 7:69118099-69118121 TATCATACATCCCAGCACTTTGG + Intergenic
1027433999 7:78144894-78144916 CAACACACACCAGAGCACATGGG - Intronic
1032043661 7:128583944-128583966 CAGCATCCAGAACAGTACTTGGG + Intergenic
1033665233 7:143434940-143434962 CTGCATGCTCCACAGCATTTTGG - Intergenic
1038204782 8:25456071-25456093 GAGCATATAACACAGCACCTTGG + Intronic
1038773143 8:30502664-30502686 CAGCAGAGACCACAGTTCTTAGG + Intronic
1040744703 8:50627429-50627451 CAGCTTTCACAACAGCATTTTGG + Intronic
1041694638 8:60722514-60722536 CAACATAAACCAAAGCTCTTTGG - Intronic
1041702570 8:60807467-60807489 CTGCATACACTACAGCAGATAGG + Intronic
1042364717 8:67923261-67923283 CAACCTCCACAACAGCACTTGGG + Intergenic
1042637245 8:70891927-70891949 CACCCAACACCACAGCACTCAGG - Intergenic
1043711326 8:83422527-83422549 CAGAATACACCAGAGGACTAGGG - Intergenic
1044959913 8:97520228-97520250 CAGCACAAGCCACAGCTCTTTGG + Intergenic
1046049168 8:109000874-109000896 TTGCATACATCCCAGCACTTTGG + Intergenic
1047954528 8:129963353-129963375 CAGCATACACCACAGCACTTCGG - Intronic
1052270550 9:26624058-26624080 AAACATCCACCACTGCACTTAGG - Intergenic
1055065017 9:72110245-72110267 CTGCATACACAATAGCACTATGG - Intergenic
1056863165 9:90205948-90205970 CATCATACACAACAGGACTGGGG + Intergenic
1056901152 9:90600552-90600574 ATGCATCCTCCACAGCACTTCGG - Intergenic
1057890249 9:98864517-98864539 CAGCAAACAGCACAGAACTCAGG - Intergenic
1061229476 9:129306336-129306358 CAGCAGTCACAACAGCACCTTGG + Intergenic
1185485780 X:481184-481206 CAGCTGTCACCACAGCACTTTGG - Intergenic
1187434587 X:19255669-19255691 CAGCATATATCACAGCACACTGG + Intergenic
1190711171 X:53071644-53071666 CACCCTACACCCCAGCACTGTGG + Intronic
1192608327 X:72543098-72543120 CAGCATACAACATAGCACAGGGG - Intronic
1195714642 X:107806739-107806761 CAGCATGCACAACAGCACAAAGG - Intergenic
1195820351 X:108938665-108938687 CAGCATGCACAACAGCACAAAGG + Intergenic
1197361081 X:125504541-125504563 CAGTATTCACCACAGGACTGGGG - Intergenic
1199845250 X:151688210-151688232 CAGCAGTCACCACAGAACTTTGG + Intergenic
1201587361 Y:15575791-15575813 CAGCAAACATCACAGCACTGAGG - Intergenic