ID: 1047954530

View in Genome Browser
Species Human (GRCh38)
Location 8:129963382-129963404
Sequence GGCTATACACAGATGAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047954526_1047954530 21 Left 1047954526 8:129963338-129963360 CCTGACTAATGAAATCCGAAGTG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1047954530 8:129963382-129963404 GGCTATACACAGATGAAGCAAGG No data
1047954528_1047954530 6 Left 1047954528 8:129963353-129963375 CCGAAGTGCTGTGGTGTATGCTG 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1047954530 8:129963382-129963404 GGCTATACACAGATGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047954530 Original CRISPR GGCTATACACAGATGAAGCA AGG Intronic
No off target data available for this crispr