ID: 1047957053

View in Genome Browser
Species Human (GRCh38)
Location 8:129984206-129984228
Sequence GACAACAGTCAGAGGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047957043_1047957053 11 Left 1047957043 8:129984172-129984194 CCTTAACAGTCCCCTGCCTCTCT 0: 1
1: 0
2: 3
3: 32
4: 309
Right 1047957053 8:129984206-129984228 GACAACAGTCAGAGGGCTGCAGG No data
1047957042_1047957053 16 Left 1047957042 8:129984167-129984189 CCTATCCTTAACAGTCCCCTGCC 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1047957053 8:129984206-129984228 GACAACAGTCAGAGGGCTGCAGG No data
1047957045_1047957053 1 Left 1047957045 8:129984182-129984204 CCCCTGCCTCTCTCTGGCTGCAG 0: 1
1: 0
2: 11
3: 94
4: 686
Right 1047957053 8:129984206-129984228 GACAACAGTCAGAGGGCTGCAGG No data
1047957048_1047957053 -1 Left 1047957048 8:129984184-129984206 CCTGCCTCTCTCTGGCTGCAGGG 0: 1
1: 0
2: 7
3: 55
4: 485
Right 1047957053 8:129984206-129984228 GACAACAGTCAGAGGGCTGCAGG No data
1047957050_1047957053 -5 Left 1047957050 8:129984188-129984210 CCTCTCTCTGGCTGCAGGGACAA 0: 1
1: 0
2: 3
3: 29
4: 247
Right 1047957053 8:129984206-129984228 GACAACAGTCAGAGGGCTGCAGG No data
1047957046_1047957053 0 Left 1047957046 8:129984183-129984205 CCCTGCCTCTCTCTGGCTGCAGG 0: 1
1: 0
2: 6
3: 80
4: 672
Right 1047957053 8:129984206-129984228 GACAACAGTCAGAGGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047957053 Original CRISPR GACAACAGTCAGAGGGCTGC AGG Intronic
No off target data available for this crispr