ID: 1047957072

View in Genome Browser
Species Human (GRCh38)
Location 8:129984310-129984332
Sequence CCTGCCTGGGAGACACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 1, 2: 2, 3: 70, 4: 622}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047957072_1047957091 28 Left 1047957072 8:129984310-129984332 CCATCCAGTGTCTCCCAGGCAGG 0: 1
1: 1
2: 2
3: 70
4: 622
Right 1047957091 8:129984361-129984383 ACTGAGCATCCAAGTGCGGGAGG No data
1047957072_1047957087 24 Left 1047957072 8:129984310-129984332 CCATCCAGTGTCTCCCAGGCAGG 0: 1
1: 1
2: 2
3: 70
4: 622
Right 1047957087 8:129984357-129984379 ACCCACTGAGCATCCAAGTGCGG No data
1047957072_1047957089 25 Left 1047957072 8:129984310-129984332 CCATCCAGTGTCTCCCAGGCAGG 0: 1
1: 1
2: 2
3: 70
4: 622
Right 1047957089 8:129984358-129984380 CCCACTGAGCATCCAAGTGCGGG No data
1047957072_1047957080 -10 Left 1047957072 8:129984310-129984332 CCATCCAGTGTCTCCCAGGCAGG 0: 1
1: 1
2: 2
3: 70
4: 622
Right 1047957080 8:129984323-129984345 CCCAGGCAGGGCTGGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047957072 Original CRISPR CCTGCCTGGGAGACACTGGA TGG (reversed) Intronic
900120746 1:1047708-1047730 CCTTCCTGGGAGGCAATGGGTGG + Intronic
900173819 1:1283316-1283338 CCTGGCTGACAGACACTGGGTGG - Intronic
900356657 1:2268256-2268278 GCCCCCTGGGAGGCACTGGAGGG - Intronic
900394776 1:2448759-2448781 CCACCCAGGGAGAGACTGGATGG - Intronic
900522675 1:3113241-3113263 CCTGGCTGTGGGCCACTGGAGGG + Intronic
900634708 1:3657291-3657313 CATGCCTGGGAACCACAGGATGG - Intronic
900680490 1:3913576-3913598 CCTGCCTGGGCGTCCCTGGGAGG - Intergenic
901037038 1:6342482-6342504 CCTGCCTGGGCAACACAGCAAGG - Intronic
901105610 1:6753775-6753797 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
901578103 1:10217367-10217389 CCAGCCTGGGAGACACAGCAAGG - Intronic
901880325 1:12190059-12190081 TCTGTCTGGGAGCCAATGGAGGG + Intronic
902024552 1:13372941-13372963 CCTGGCTGGGAGAGACTAAAGGG + Intergenic
902148947 1:14426737-14426759 TCAGCTTGGGAGGCACTGGATGG - Intergenic
902295444 1:15463624-15463646 GCTGCCTTGGAGAGACGGGATGG + Intronic
902298334 1:15483502-15483524 GCTGCCTTGGAGAGACAGGATGG + Intronic
903036055 1:20493286-20493308 CCTGCCTTGGAGCCTGTGGAAGG - Intergenic
903557553 1:24204677-24204699 CCAGCCTGGGTGACAGAGGAAGG - Intergenic
903636573 1:24822376-24822398 CCAGCCTGGGCGACACAGCAAGG - Intronic
904227068 1:29030850-29030872 CCAGCCTGGGAGACAGAGCAAGG - Intronic
904679472 1:32218906-32218928 CCAGCCTGGGTGACACAGCAAGG + Intronic
904741437 1:32679265-32679287 CCAGCCTGGGAGACAGAGCAAGG + Intronic
904760127 1:32797174-32797196 CCTGCCTGGGCAACACAGGGAGG + Intronic
904926522 1:34053333-34053355 CCTGTCTGGGAAAGACTGAAAGG + Intronic
905016766 1:34783216-34783238 CCAGCCTGGGCGACACAGCAAGG + Intronic
905086405 1:35382478-35382500 CCAGCCTGGGAGACAGTGCAAGG - Intronic
905108445 1:35577538-35577560 CCAGGCTGGGAGGCACTGTAGGG - Intronic
905184262 1:36185050-36185072 CCAGCCTGGGAGACAGAGCAAGG + Intergenic
905470152 1:38185725-38185747 CCTCCCTGGCAGACACTGGGAGG + Intergenic
905863323 1:41364254-41364276 CCGGCTTTGGAGACCCTGGAGGG - Intronic
906189001 1:43883657-43883679 CCTGCCTGGGTGGAACTAGAGGG + Intronic
906239195 1:44231401-44231423 CCTGCCTGGGTGACAGAGTAGGG - Intronic
906313157 1:44768230-44768252 CCAGCCTGGGAGACAGAGTAAGG + Intergenic
907344495 1:53763525-53763547 CCTGGCAGAGAAACACTGGAAGG - Intergenic
907554801 1:55334538-55334560 CCTGCCCAGGAGCCACTGGGAGG - Intergenic
908705077 1:66944753-66944775 CCAGCCTGGGAGACAGAGCAAGG - Intronic
908794966 1:67821990-67822012 CTTCCCTGGGCCACACTGGAAGG + Intronic
910716550 1:90237085-90237107 CCAGCCTGGGAGACACAGCAAGG - Intergenic
910854192 1:91678660-91678682 CCAGCCTGGGTGACAGAGGAAGG - Intergenic
911251681 1:95583748-95583770 CCTGCCTGGAATAGACTGAAAGG + Intergenic
911902820 1:103526275-103526297 CCTTCCCGGGAGACTCCGGAGGG - Intronic
912070648 1:105805860-105805882 CTTGCATGGGAAACACTGGGTGG - Intergenic
912989831 1:114474370-114474392 CCAGCCTGGGTGACACAGCAAGG + Intronic
913069818 1:115288551-115288573 CCTGACTGTGAGATACTCGAGGG + Intronic
913192878 1:116428441-116428463 TCTTCCCTGGAGACACTGGAAGG + Intergenic
913252664 1:116924893-116924915 CCTCCCTGTGAGACTCTGGAGGG - Intronic
913371700 1:118106830-118106852 CCTACCTAGGAGAACCTGGAGGG - Intronic
913674446 1:121128102-121128124 CTTGCCTGGGAAAAGCTGGAAGG - Intergenic
913962654 1:143352263-143352285 CCAGCCTGGGAGACATAGGGAGG + Intergenic
914026231 1:143915411-143915433 CTTGCCTGGGAAAAGCTGGAAGG - Intergenic
914057009 1:144177848-144177870 CCAGCCTGGGAGACATAGGGAGG + Intergenic
914122137 1:144788518-144788540 CCAGCCTGGGAGACATAGGGAGG - Intergenic
914664668 1:149823164-149823186 CTTGCCTGGGAAAAGCTGGAAGG - Intergenic
914875958 1:151512861-151512883 CCAGCCTGGGAAACACAGGAAGG - Intronic
914993369 1:152517424-152517446 CTTGCCAGGGAGGCTCTGGAGGG + Intronic
915258301 1:154653274-154653296 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
915330077 1:155105935-155105957 CATGACTGGGAGCCACTGGAGGG + Intergenic
916020695 1:160789762-160789784 CGAGCCTGGGAGGCAGTGGAGGG + Intergenic
916071718 1:161174045-161174067 CCAGCCTGGAAGATAATGGAGGG + Exonic
917081525 1:171260881-171260903 CCAGCCTGGGTGACACAGAAAGG + Intronic
917806983 1:178622605-178622627 CTTCCCTGGGCCACACTGGAAGG + Intergenic
919873090 1:201838947-201838969 CCAGCCTGGGTGACACAGCAAGG - Intronic
920143410 1:203837481-203837503 CCTGCCTGGGCGATACAGCAAGG - Intronic
920657559 1:207887962-207887984 CAGGGCTGTGAGACACTGGATGG + Intronic
921218116 1:212953937-212953959 CCAGCCTGGGTGACAGAGGAAGG - Intronic
922112276 1:222572381-222572403 CCAGCCTGGGAGACAAAGTAAGG - Intronic
922325908 1:224528232-224528254 CCAGCCTGGGTGACAGTGCAAGG + Intronic
922988735 1:229886886-229886908 CCTAACTGGGAGCCACTGGCAGG - Intergenic
923400942 1:233614719-233614741 TCTGCCTGGGTGACTCGGGAGGG + Intronic
923744269 1:236686327-236686349 GCTGCAGGGGAGACAGTGGAGGG + Intergenic
924666173 1:246074137-246074159 CTTCCCTGGGCCACACTGGAAGG - Intronic
924699205 1:246433629-246433651 CCAGCCTGGGTGACACAGCAAGG + Intronic
1062872085 10:913877-913899 CCAGCCTGGGTGACACAGTAAGG + Intronic
1062963548 10:1591261-1591283 CCTGCCTCGGCCACACTGCAGGG + Intronic
1063054901 10:2494601-2494623 CCTTCCTGGAGGGCACTGGATGG - Intergenic
1063502548 10:6568525-6568547 CCAGCCTGGGAGACAGAGCAAGG - Intronic
1064030921 10:11882183-11882205 CCTGCCCAGGAGAGACTGGGTGG + Intergenic
1064037984 10:11930746-11930768 CCAGCCTGGGTGACAGAGGAAGG + Intronic
1064251708 10:13710982-13711004 CCAGCCTGGGCGACACAGCAAGG + Intronic
1064450016 10:15433588-15433610 CTGGCCTGGGAGACAGAGGAAGG - Intergenic
1065004990 10:21371215-21371237 CCAGCCTGGGTGACAGAGGAAGG + Intergenic
1065091943 10:22244133-22244155 TCTGCAGGGGAGACAGTGGAGGG - Intergenic
1065791502 10:29264620-29264642 CCAGCCTGGGTGACAGTGGGAGG + Intergenic
1066466895 10:35659691-35659713 CCTGCATGGTAGGCACTGGGTGG + Intergenic
1066536136 10:36394384-36394406 CCAGCCTGGGTGACAGTGGGAGG - Intergenic
1066694345 10:38064600-38064622 CCGGGCTAGGAGACACTGGCTGG + Intronic
1067048488 10:42999152-42999174 CCCTCCTGGGTGACCCTGGAGGG - Intergenic
1067768123 10:49104267-49104289 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1068234369 10:54214619-54214641 CCAGCCTGGGTGACACAGCAGGG - Intronic
1068359021 10:55952003-55952025 CCAGCCTGGGTGACAGAGGAAGG - Intergenic
1069530807 10:69217993-69218015 CCAGCCTGGGCAAGACTGGATGG + Intergenic
1069546805 10:69334803-69334825 TCTGCCTGGGAGACACTTCGTGG - Intronic
1069867909 10:71515041-71515063 CCTCCCTGGGGCACACTGGAGGG - Intronic
1070204356 10:74241730-74241752 CCAGCCTGGGAGACAGAGCAAGG - Intronic
1070846337 10:79525109-79525131 CCTGTGTGGGAGACTGTGGAGGG - Intergenic
1070927460 10:80235197-80235219 CCTGTGTGGGAGACTGTGGAGGG + Intergenic
1072407913 10:95171657-95171679 CCTGTGTGGGAGACTGTGGAGGG - Intergenic
1073096729 10:100984472-100984494 CCTGCCTGGGAGAAAGAGAAAGG - Exonic
1073116226 10:101093413-101093435 CCTGTCTGGGAGGCTTTGGACGG + Intronic
1073200588 10:101731890-101731912 CCAGCCTGGGTGACAGTGTAGGG + Intergenic
1073928629 10:108547207-108547229 TCAGCCTGGGAGACAGTGCAAGG - Intergenic
1073953204 10:108835310-108835332 ACTGCCTGGTGGACACTGGATGG - Intergenic
1074266019 10:111904145-111904167 CCTGCCTGGGTGACAGAGCATGG - Intergenic
1076110146 10:127853988-127854010 CCAGCATGTGAGACGCTGGAGGG - Intergenic
1076364774 10:129914727-129914749 CCTGCATGGGAGACCCTGGGAGG + Intronic
1076584712 10:131537783-131537805 CCAGCCTGGGTGACAGAGGAAGG - Intergenic
1076609882 10:131717471-131717493 CCAGCCTGGGTGACACAGCAAGG + Intergenic
1076743310 10:132499022-132499044 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
1076859613 10:133134467-133134489 CCTGTCTGGGAGAGGCTGGGGGG - Intergenic
1076928386 10:133507778-133507800 CCTTCCAGGGAGAAACTGGAAGG - Intergenic
1077094486 11:793498-793520 TCTGCCTGGCAGACACTCGAGGG - Intronic
1077119462 11:900140-900162 CGTGACTGGGAGATGCTGGAGGG + Intronic
1078128879 11:8595083-8595105 CCAGCCTGGGTAACACTGGGAGG + Intergenic
1078602391 11:12745079-12745101 GCTCCCTGGGAGACACTGCTGGG + Intronic
1078934150 11:15937680-15937702 ACTCTCTGGGAGAGACTGGAAGG - Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079024922 11:16939382-16939404 CCAGCCTGGGTGACACAGCAAGG + Intronic
1080178362 11:29393932-29393954 CCTACCTGGGAGAAACTGTATGG + Intergenic
1080492400 11:32780242-32780264 CCAGCCTGGGCAACACAGGAAGG + Intronic
1080591159 11:33724077-33724099 CCAGCCTGGGTGACACAGCAAGG + Intronic
1080633642 11:34104683-34104705 TCTGACGGGGTGACACTGGATGG - Intergenic
1080830528 11:35889678-35889700 CTTGCCTTGGAGACACTTGATGG + Intergenic
1080987799 11:37491815-37491837 TCTGCCTGGAACACACTGGATGG + Intergenic
1081155817 11:39688494-39688516 CCAGCCTGGGAGACAGAGGGAGG + Intergenic
1082679243 11:56148343-56148365 CCAGCCTGGGCGACACAGGCTGG - Intergenic
1082743615 11:56938777-56938799 CCTGCCTGGGTGACAGGGCAAGG - Intergenic
1082773902 11:57231078-57231100 CCTGTCGTGGAGACAATGGAAGG - Intergenic
1082930987 11:58604804-58604826 CTTCCCTGGGCCACACTGGAAGG - Intronic
1083152070 11:60798168-60798190 CCCACATGGGAGTCACTGGATGG - Intronic
1083462320 11:62822331-62822353 CCAGCCTGGGCGACACAGCAAGG + Intronic
1083540996 11:63511444-63511466 CCAGCCTGTGAGCAACTGGACGG - Intronic
1083992329 11:66254190-66254212 CCTGCCTGGGGAACACAGCAAGG + Intergenic
1084282085 11:68103881-68103903 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1085622931 11:78050869-78050891 CCTATCTGGGAGCCCCTGGAGGG - Intronic
1086162212 11:83734478-83734500 CCAGCCTGGGTGACACAGCAAGG - Intronic
1086163823 11:83753391-83753413 CCAGCCTGGGTGACACAGCAAGG + Intronic
1086418884 11:86618268-86618290 CCTGCCTGGGCGACAGAGCAAGG + Intronic
1086965232 11:93020429-93020451 CCTGCCTATGAATCACTGGAAGG + Intergenic
1087080866 11:94169763-94169785 CCTGCCATGGAGACTCGGGAGGG + Intronic
1088672986 11:112161768-112161790 CCAGCCTGGGTGACACAGCAGGG + Intronic
1089368314 11:117934664-117934686 CTTGCCTGGGAGGTCCTGGAGGG - Intergenic
1089621378 11:119724329-119724351 CCTGCCAGGGAGACAACAGAAGG + Intronic
1089681831 11:120122869-120122891 CCTGGCTGAGAGTCACTGCACGG + Intronic
1089681892 11:120123151-120123173 TCTGCCTGGGAGATAGGGGAAGG - Intronic
1090774387 11:129950200-129950222 CCAGCCTGGGTGACACAGCAAGG + Intronic
1091497087 12:981967-981989 CATGCCTCTGAGGCACTGGATGG + Intronic
1091911255 12:4232361-4232383 CCAGGCTGGGAGAAACTGGCTGG + Intergenic
1092125474 12:6072276-6072298 CCTGCCTGGGGGACTGGGGAGGG - Intronic
1092227319 12:6756160-6756182 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1092447705 12:8573161-8573183 CCAGCCTGGGAGACACAGCAAGG - Intergenic
1092947613 12:13471652-13471674 CCTGCGTGGGAGCCACTGATGGG + Intergenic
1093384406 12:18533977-18533999 CCAGCCTGGGAGACAGAGCAAGG - Intronic
1093471428 12:19506124-19506146 CCGGCCTGGGTGACACAGCAAGG - Intronic
1094198458 12:27774116-27774138 CCAGCCTGGGAGACACAGCAAGG + Intergenic
1095876960 12:47089801-47089823 CCAGCCTGGGTGACACAGCAAGG - Intronic
1096184516 12:49569769-49569791 CCAGCCTGGGTGACAGAGGAAGG - Intronic
1096567297 12:52492562-52492584 CCTGCCAGGGAGACCTAGGAGGG - Intronic
1096726654 12:53569140-53569162 CCGGCCTGGGCGACAGAGGAGGG + Intronic
1096781670 12:53995620-53995642 CCAGCCTGGGAGTGGCTGGAGGG - Intronic
1096817376 12:54210128-54210150 ACTCCCAGGGAGACTCTGGAGGG + Intergenic
1098373058 12:69780446-69780468 CCTGCCTGGGCTACCCTGGTGGG - Intronic
1101328211 12:103735518-103735540 ACTGCCTGGAAGACCCTGCAAGG + Exonic
1101802224 12:108032534-108032556 CCAGCCTGGGAGACAGAGGGAGG - Intergenic
1102451789 12:113047342-113047364 CCAGCCTGGGAGACAAAGCAAGG + Intergenic
1102695423 12:114795409-114795431 CCAGCCTGGGCGACACAGCAAGG - Intergenic
1102889635 12:116548322-116548344 CCTGCCTTGGCGGCACTGAAGGG + Intergenic
1103000932 12:117384822-117384844 CCTGTCTGAGGGTCACTGGAGGG + Intronic
1103299271 12:119915533-119915555 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
1103300371 12:119921664-119921686 CCAGCCTGGGTGACAGTGCAAGG + Intergenic
1103477694 12:121230711-121230733 CAGGCCTGGGAGACACAGGCAGG - Intronic
1103518996 12:121525294-121525316 CCAGCCTGGGTGACACAGTAAGG - Intronic
1103804810 12:123563960-123563982 CCAGCTTGGGAGACACAGGCTGG + Intergenic
1104221109 12:126785907-126785929 CTGGCCTGGGAGGCACTGGGTGG + Intergenic
1104240060 12:126979802-126979824 CCAGCCTGGGAGACAGAGGGAGG - Intergenic
1104471595 12:129034088-129034110 CCAGCCTGGGAGACAGAGAAAGG - Intergenic
1104931300 12:132340774-132340796 CCTGCCTTGGTGTAACTGGAGGG - Intergenic
1105018131 12:132798578-132798600 CTTGCGTGGGAGACACTGAGGGG - Intronic
1105437149 13:20389183-20389205 CCAGCCTGGGTGACACAGCAAGG - Intergenic
1105958322 13:25305171-25305193 CCAGCCTGGGAGACAGGGCAAGG - Intronic
1106386370 13:29289844-29289866 TCTGCCTATGAGAGACTGGAAGG - Intronic
1106709252 13:32313394-32313416 CCTGCCTGGGAGACAGAGCAAGG - Intronic
1107293267 13:38881338-38881360 ACTACTTGGGAGACAGTGGAAGG + Exonic
1108387183 13:49910321-49910343 CCTGGCAGGGAGACACTGTTGGG - Intergenic
1109217401 13:59605073-59605095 CCTGCCTGGGTGACAGAGCAAGG + Intergenic
1111475085 13:88735352-88735374 CCAGCCTGGGAGACAGAGGGAGG + Intergenic
1112206110 13:97324843-97324865 CCTGCATGGGAGAAACATGAAGG + Intronic
1112384872 13:98930363-98930385 ACTGGATGGGAGAAACTGGAGGG - Intronic
1112479877 13:99765571-99765593 CCAGCCTGGGTGACACAGGGAGG - Intronic
1113427776 13:110223796-110223818 CCTGCCTGGGTGACACCCCAAGG + Intronic
1113864363 13:113511569-113511591 CCTCCCTGCTAGACGCTGGACGG + Intronic
1116825414 14:49668828-49668850 CCAGCCTGGGTGACAGTGTAAGG - Intronic
1116875081 14:50103117-50103139 CTTCCCTGGGCCACACTGGAAGG - Intergenic
1118079922 14:62347019-62347041 CTTTCCTGGGCCACACTGGAAGG + Intergenic
1118353117 14:64988280-64988302 CTTCCCTGGGACACACTGGTAGG - Intronic
1118612844 14:67554940-67554962 CCAGCCTGGGTGACACAGCAAGG - Intronic
1118726173 14:68630516-68630538 CCGGACTTGGAGACATTGGAAGG + Intronic
1118835796 14:69477039-69477061 CCAGCCTGGGTGACACCAGAGGG - Intergenic
1119367505 14:74106618-74106640 CCAGCCTGGGAGACAAAGCAAGG - Intronic
1119424646 14:74527726-74527748 CCTGGCTGGGAGGCATGGGAGGG - Intronic
1119834034 14:77731287-77731309 CCTGCCTGGAAGACACTGCAAGG + Intronic
1121248059 14:92477810-92477832 CCAGCCTGGGAGACAAAGCAAGG - Intronic
1121325865 14:93019267-93019289 CCTGCCTGGGAGAAACTGTGGGG + Intronic
1122099477 14:99395760-99395782 ACTGCCTGGGAGACACTGCCTGG + Intergenic
1122529472 14:102415738-102415760 CTTTCCTGGGAGACACAAGACGG - Intronic
1122647560 14:103205606-103205628 CCAGCCTGGGTGACACAGCAAGG + Intergenic
1122660771 14:103293567-103293589 TCTGTCTGGGAGACACAGGAAGG - Intergenic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1123037208 14:105476337-105476359 CCTGCCTGGGAGGCACTGTGAGG + Intronic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1123756569 15:23401651-23401673 CAGGCTGGGGAGACACTGGATGG - Intergenic
1123773705 15:23556028-23556050 CCTGCCTGGGAGACAGAGTGAGG - Intergenic
1124071020 15:26393328-26393350 CCAGCCTGAGAGCCACTGGTGGG + Intergenic
1125796345 15:42406741-42406763 CCTGCCAGGCACACACTGGCAGG - Intronic
1126201278 15:45989337-45989359 CCAGCCTGGGAGACAGAGCAAGG + Intergenic
1127102555 15:55582175-55582197 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1127318558 15:57819746-57819768 GCTACATGGGAAACACTGGAGGG - Intergenic
1127481214 15:59379280-59379302 CCAGCCTGGGAGACACAGTGTGG - Intronic
1128877473 15:71214262-71214284 GCTGGCTGGGAGGGACTGGAGGG - Intronic
1129244380 15:74270759-74270781 TGGGCCTGGGGGACACTGGAAGG - Intronic
1129286153 15:74526696-74526718 CCAGCCTGGGTGACAGTGCAAGG + Intergenic
1129427864 15:75477868-75477890 CCAGCCTGGGCGACAGAGGAAGG - Intronic
1129609833 15:77044414-77044436 CTTGCCTGGGAACCACTAGAAGG - Exonic
1130048331 15:80463244-80463266 CATGTGTGGGACACACTGGATGG + Intronic
1131142900 15:89992135-89992157 GTTGCCTGGGAGACCCTTGATGG + Intergenic
1131480517 15:92776829-92776851 CCAGGCTGGGAGACACAGCAAGG + Intronic
1131835489 15:96386490-96386512 CCAGCCTGGGTGACACAGGGAGG - Intergenic
1132381782 15:101371175-101371197 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1132540791 16:508401-508423 CCAGCCTGGGTGACACAGCAAGG - Intronic
1132672159 16:1106381-1106403 GCTGCCTGGCAGAGTCTGGATGG + Intergenic
1132754121 16:1474504-1474526 CCAGTCTGGGGGACACCGGAGGG + Intronic
1133085722 16:3361358-3361380 CCAGCCTGGGAGACACAGTGAGG + Intergenic
1133118299 16:3590735-3590757 TCTGCCTGGCAGTCCCTGGAAGG + Exonic
1133295835 16:4751876-4751898 CCCGCCTGGGGGACACAGCAAGG + Exonic
1133736376 16:8619117-8619139 CCTGCCTGGGACACTAGGGAGGG + Intergenic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1134136051 16:11677039-11677061 CCTGCCTGGGAGCCAGTGAAGGG + Exonic
1134298484 16:12968158-12968180 CCAGCCTGGGTGACAGAGGAAGG + Intronic
1134481556 16:14623805-14623827 CCAGCCTGGGCGACAGTGTAAGG + Intronic
1134798117 16:17060232-17060254 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
1135089255 16:19499908-19499930 CCAGCCTGGGAGACAGAGGGAGG - Intergenic
1135179845 16:20263124-20263146 CCAGCCTGGGTGACACAGTAAGG + Intergenic
1135196408 16:20398599-20398621 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1135222302 16:20623651-20623673 CCTGCATGGGAGACTGTGGAGGG - Intronic
1135313397 16:21422861-21422883 CCTGCATGGGAGACTGTGGAGGG - Intronic
1135342391 16:21660423-21660445 CCAGCCTGGGCGACAGAGGAAGG - Intergenic
1135366321 16:21855139-21855161 CCTGCATGGGAGACTGTGGAGGG - Intronic
1135445494 16:22516025-22516047 CCTGCATGGGAGACTGTGGAGGG + Intronic
1135514483 16:23118941-23118963 CCAGCCTGGGTGACACTGCAAGG + Intronic
1135630737 16:24034179-24034201 CCTGCCTCAGAGACAGTGGTGGG + Intronic
1135686652 16:24503221-24503243 CCAGCCTGGGAGACTCTGTCTGG - Intergenic
1135748702 16:25039092-25039114 CCAGCCTGGGTGACACAGCAAGG - Intergenic
1136152544 16:28360581-28360603 CCTGCATGGGAGACTGTGGAGGG - Intronic
1136194205 16:28640601-28640623 CCTGCATGGGAGACTGTGGAGGG + Intronic
1136210538 16:28754700-28754722 CCTGCATGGGAGACTGTGGAGGG + Intronic
1136310062 16:29401563-29401585 CCTACATGGGAGACTGTGGAGGG - Intronic
1136323508 16:29503366-29503388 CCTGCATGGGAGACTGTGGAGGG - Intronic
1136438193 16:30243335-30243357 CCTGCATGGGAGACTGTGGAGGG - Intronic
1136471478 16:30483700-30483722 CCGGCCTGGGAGATCCAGGAAGG + Intronic
1138603383 16:58071224-58071246 CCTGCCTGAGAGTCCCTGCAGGG + Intergenic
1139383131 16:66547292-66547314 CCTAACTGGGTGAGACTGGAAGG - Intronic
1139639808 16:68282996-68283018 CCTGTCTGGGAGGAATTGGAAGG + Intronic
1139857747 16:69993965-69993987 CCTGCATGGGAGACTGTGGAGGG - Intergenic
1139876590 16:70150962-70150984 CCAGCCTGGGCGACAGTGGGAGG - Intronic
1140203987 16:72918723-72918745 CCAGCCTGGGAGACAGAGCAAGG - Intronic
1140815444 16:78616734-78616756 CCTGTCTGGGAGACAGAGGGAGG + Intronic
1141115990 16:81309707-81309729 CCAGCCTGGGAGACACAGTAAGG - Intergenic
1141524492 16:84603133-84603155 TCTGCCTGGGAGCCCCTGGTTGG + Intronic
1141683443 16:85556856-85556878 CCTGCCTGGGATTCCCTGGAAGG + Intergenic
1141887986 16:86905958-86905980 TCTGCCTAGCAGACACTGGCTGG - Intergenic
1142209021 16:88798904-88798926 CCTGTCTGGGGGAGCCTGGATGG + Intergenic
1142210231 16:88805103-88805125 CCTGCCTCGGGGACTCTGGCAGG + Intronic
1142524466 17:529830-529852 CCAGCCTGGGAGACACAGGGAGG + Intronic
1142678320 17:1529511-1529533 CCAGCCTGGGTGACACAGCAAGG + Intronic
1142738263 17:1915372-1915394 CCTGGCTGGGAGAATCTCGATGG - Intergenic
1144535145 17:16081534-16081556 GCTGCCTGGCAGCCACTAGAAGG + Intronic
1145200476 17:20940550-20940572 CCAGCCTGGGCGACAGAGGAAGG - Intergenic
1145209100 17:21000064-21000086 TCTTCCTGGGAGGCACTGAAAGG + Exonic
1145853605 17:28129421-28129443 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1146003621 17:29147150-29147172 CCTGCCTGGAAAACAATGGGAGG + Intronic
1146193992 17:30795613-30795635 CCAGCCTGGGCGACACAGCAAGG + Intronic
1146372857 17:32276021-32276043 CCTGCCTGAGGCACTCTGGAAGG - Intronic
1146899896 17:36576818-36576840 CCAGCCTGGGTGACTCTGAATGG + Intronic
1147432065 17:40377803-40377825 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
1147627000 17:41906789-41906811 CATGCCTTGAAGACACTTGATGG + Intronic
1147865607 17:43550075-43550097 CCAGTCTGGGAGACACTAAAGGG - Intronic
1148025715 17:44586280-44586302 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
1148274116 17:46288336-46288358 CCAGCCTGGGAGACAGAGCAAGG - Intronic
1148399046 17:47337673-47337695 GCAGCCTGGGAAACACTGGGAGG + Intronic
1148812488 17:50302642-50302664 CCAGCCTGGGTGACAGAGGAAGG - Intergenic
1148832343 17:50441868-50441890 CCAGCCTGGGAGACAGAGTAAGG - Intronic
1148875573 17:50684912-50684934 CCTCCCTGGGAAACCCTGGCGGG + Intronic
1149005200 17:51797819-51797841 CCTGCCTGGGTGACAGAGCAAGG + Intronic
1149353335 17:55814018-55814040 CCAGCCTGGGTGACAGAGGAAGG + Intronic
1150160795 17:62896209-62896231 CCAGCCTGGGTGACACAGCAAGG - Intergenic
1150295253 17:64003950-64003972 CCTGCCTTGGAGGCTCTGCAGGG + Exonic
1150354739 17:64473319-64473341 CCAGCCTGGGCGACAGAGGAAGG + Intergenic
1150725814 17:67650476-67650498 CCAGCCTGGGAGACAGAGCAAGG - Intronic
1151527356 17:74679946-74679968 CCAGCCTGGGTGACACAGCAAGG + Intronic
1151552446 17:74829915-74829937 ACTGCCTGGGAGGACCTGGAAGG + Intronic
1151670968 17:75571560-75571582 CCCTCCTGGGAGAGGCTGGAAGG - Intronic
1151890355 17:76947762-76947784 TGTGCCTGGGAGACACCTGAAGG - Intronic
1151894818 17:76972853-76972875 AATCCCTGGGAGACAGTGGATGG + Intergenic
1152268201 17:79308470-79308492 CCTCCCTGCTAGACACTGGGTGG + Intronic
1153805401 18:8705655-8705677 CCGGCCATGGAGACACTGAACGG + Intronic
1154006536 18:10534115-10534137 CCAGCCTGGGCGACACAGCAAGG + Intronic
1154119191 18:11637218-11637240 CCTGCATGGGAGACTGTGGAGGG - Intergenic
1154238911 18:12633544-12633566 CCAGCCTGGGAGACACAGCAAGG + Intronic
1155026037 18:21941858-21941880 CCCGCCTGGGAGACAGAGCAAGG - Intergenic
1155083411 18:22432191-22432213 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
1155277962 18:24207773-24207795 CCAGCCTGGGTGACAGAGGAAGG - Intronic
1156074095 18:33251569-33251591 ACTGCTAGGGAGACACTCGAAGG - Intronic
1156115059 18:33777794-33777816 CGTGGTAGGGAGACACTGGAGGG + Intergenic
1156653060 18:39250940-39250962 CCAGCCTGGGAGACAGAGCAAGG + Intergenic
1156947525 18:42852861-42852883 CCAGCCTGGGAGACAGAGAAAGG - Intronic
1157319823 18:46625414-46625436 CTTCCCTGGGCCACACTGGAAGG + Intronic
1157840438 18:50953127-50953149 CCAGCCTGGGAGACAGAGCAAGG - Exonic
1157895392 18:51461719-51461741 CCTGTCTGGTAGAGAATGGATGG + Intergenic
1158572520 18:58609109-58609131 CCTAGCTGGGAGACACAGGGAGG - Intronic
1159036819 18:63285559-63285581 ACTGCCGGGGAGGTACTGGATGG + Intronic
1159054925 18:63453871-63453893 CCTGTCTGGGAGGAACTGAATGG - Intergenic
1160466997 18:79086404-79086426 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1160558570 18:79741693-79741715 CCTGCGTGGGAGACACAGGGCGG + Intronic
1161098648 19:2408957-2408979 CCAGCCTGGGTGACAGTGGGAGG + Intronic
1161348947 19:3781986-3782008 CCTGACTGGGAGTTCCTGGAGGG - Intronic
1161377985 19:3950007-3950029 CCTGCCTGGGAGGCACTGGAGGG + Intergenic
1161567141 19:5009759-5009781 CCAGCCTGGGAGACAGAGCAAGG - Intronic
1162091171 19:8280935-8280957 CCAGCCTGGGAGACAAAGCAAGG - Intronic
1162093405 19:8295790-8295812 CCAGCCTGGGAGACAAAGCAAGG - Intronic
1162370324 19:10274907-10274929 CCTGCCTGGGAACAACCGGAAGG + Exonic
1162450677 19:10752547-10752569 CCTGGCTGGGAGTTACTGGAGGG + Intronic
1162581518 19:11534054-11534076 CCAGCCTGGGAGACATGGCAGGG - Intergenic
1162966985 19:14160665-14160687 CAAGGCTGGTAGACACTGGAAGG + Exonic
1163087775 19:14994619-14994641 CCTGCCTTGGAGAATCTGGTGGG + Intronic
1163270695 19:16251721-16251743 CCTTCCTGGGAGATCCAGGAGGG - Intergenic
1163758774 19:19121692-19121714 CCTGCCTGGGGGACCCTGGGAGG + Intronic
1164418659 19:28067587-28067609 TCTGCCATGGAGCCACTGGATGG - Intergenic
1164683696 19:30152922-30152944 AATGCCTGGCAGGCACTGGAAGG - Intergenic
1164838784 19:31376894-31376916 CCAGCCTGGGTGACAGTGCAAGG - Intergenic
1164873105 19:31663204-31663226 CCAGCCTGGGAGACAGTGTGAGG + Intergenic
1164959993 19:32419887-32419909 CCAGCCTGGGTGACACAGCAAGG - Intronic
1164980047 19:32607113-32607135 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1165184640 19:34007264-34007286 CCAGGCTGGGGGATACTGGAGGG - Intergenic
1165705909 19:37976073-37976095 CCTGCCTGGGTGACAGAGCAAGG + Intronic
1165747571 19:38239182-38239204 CCAGCCTGGGAGACAGAGCAAGG + Intergenic
1165759486 19:38312383-38312405 CCAGCCTGGGCGACACAGCAAGG + Intronic
1166160619 19:40950143-40950165 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
1166169519 19:41017881-41017903 CCAGCCTGGGAGACAGAGCAAGG - Exonic
1166335737 19:42105841-42105863 CCTGCCTGGGGGCGAATGGATGG - Intronic
1166619621 19:44284387-44284409 CCAGCCTGGGTGACACAGCAAGG + Intronic
1166931185 19:46302458-46302480 CCAGCCTGGGTGACACAGCAAGG - Intronic
1167105845 19:47429627-47429649 CCTCCCTGGGGGACCCTCGAAGG - Exonic
1167193132 19:48005988-48006010 CCAGCCTGGGCGACACAGCAAGG - Intronic
1167291955 19:48629393-48629415 CCAGACTGGGTGACGCTGGAGGG + Exonic
1167295625 19:48647402-48647424 CCAGCCTGGGTGACATTGCAAGG - Intergenic
1167703366 19:51064456-51064478 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1167705472 19:51078947-51078969 CCTGGCTGGGGGACACTGCAGGG + Exonic
1168033016 19:53696376-53696398 CCAGCCTGGGAGACACAGAGAGG - Intergenic
1168250880 19:55141323-55141345 CCGTCCTAGGAGACCCTGGAGGG + Intronic
1202696492 1_KI270712v1_random:130521-130543 CCAGCCTGGGAGACATAGGGAGG + Intergenic
925014698 2:513808-513830 CCAGCCTGGGTGACACAGCAGGG + Intergenic
925380395 2:3421021-3421043 CCTGCCTGACAGAGACTGCAAGG - Intronic
926289251 2:11515652-11515674 TCCTCCTGGGAGACACAGGAGGG - Intergenic
927668779 2:25051663-25051685 CCAGCCTGGGCGACACAGCAAGG - Intronic
927702754 2:25278191-25278213 CCTGTCAGGGCCACACTGGAAGG - Intronic
928100233 2:28432534-28432556 ACTGCCTGGGGCACCCTGGAAGG - Intergenic
929053968 2:37860127-37860149 CCAGCCTGGGAGCTCCTGGAGGG + Intergenic
929200592 2:39231180-39231202 CCAGCCTGGGAGACAGAGCAAGG + Intergenic
929603892 2:43222068-43222090 CCTGCCTGTGAGTCACTGAGTGG - Intergenic
929706864 2:44222758-44222780 CCTGCATGGTAGACACAGGTGGG - Intronic
931185382 2:59945940-59945962 CATGCCTGGGAGACTTGGGAAGG - Intergenic
934077175 2:88438351-88438373 CCAGCCTGGGCGACAGAGGAAGG - Intergenic
934277654 2:91587546-91587568 CCAGCCTGGGAGACATAGGGAGG + Intergenic
934300190 2:91772277-91772299 CCAGCCTGGGGCTCACTGGAGGG + Intergenic
934913934 2:98282904-98282926 CCTGCCTGGGTGACAGTGAATGG - Intronic
935539323 2:104330611-104330633 CCAGCCTGGGTGACAGAGGAAGG + Intergenic
935685216 2:105677083-105677105 CCAGCCTGGGCGACACAGCAAGG - Intergenic
935685222 2:105677119-105677141 CCAGCCTGGGCGACACAGCAAGG - Intergenic
935713295 2:105917929-105917951 CCTTGCTGGGTGACACTGGCAGG + Intergenic
935761413 2:106324195-106324217 GCTGGCTGGGACACACTGCACGG + Intergenic
936157858 2:110060863-110060885 CCAGCCTGGGAGACACAGCGAGG - Intergenic
936186834 2:110310584-110310606 CCAGCCTGGGAGACACAGCGAGG + Intergenic
937109667 2:119354491-119354513 CCAGCCTGGGAGACAGTGTGAGG + Intronic
937240714 2:120460683-120460705 GCTGCTTGGGAGACCCTGCAAGG - Intergenic
940251023 2:151676687-151676709 CTTGCCTGGGAAACTCTGGTAGG + Intronic
940321586 2:152383184-152383206 CCTCCCTTGGAAACACTGGAAGG + Intronic
941099172 2:161278150-161278172 CCAGCCTGGGTGACAGTGTAAGG + Intergenic
941956976 2:171214968-171214990 CCAGCCTGGGAGACAGAGCAAGG - Intronic
942934984 2:181543952-181543974 CCAGCCTGGGTGACACAGCAAGG + Intronic
943258113 2:185623244-185623266 TGTGCATGGGAGACCCTGGAAGG - Intergenic
943538253 2:189179853-189179875 GTTGCTTGGCAGACACTGGATGG - Exonic
943887718 2:193243573-193243595 CCAGCCTGGGAGACAAAGTAAGG + Intergenic
944660257 2:201915940-201915962 CCTGCCTGGGAGACCAGGCAAGG + Intergenic
947558844 2:231127382-231127404 CCAGCCTGGGTGACAGAGGAAGG - Intronic
947563173 2:231175938-231175960 CCCGCCTGGGTGACATGGGATGG - Intergenic
948182439 2:235992918-235992940 CCTACCTGGGAGAACCTGGCTGG + Intronic
948540968 2:238691293-238691315 CCAGCCTGGGAGAAAGGGGAGGG - Intergenic
948783716 2:240340257-240340279 CATCCCGGGCAGACACTGGAAGG - Intergenic
948997903 2:241593213-241593235 CCAGCCTGGGCGACAGTGCAAGG + Intronic
1168784286 20:524390-524412 CCAGCCTGGGAGACAGAGGGAGG + Intronic
1168884569 20:1238851-1238873 CCAGCCTGGGCGACACAGCAAGG - Intronic
1169109650 20:3023960-3023982 CATGCCTGGGAGAGTCAGGAAGG + Intronic
1169595560 20:7194377-7194399 CCTGCCTGGGTGACAGAGCAAGG + Intergenic
1170712943 20:18808511-18808533 CCTGCATGGGATACACAGAAGGG - Intergenic
1170935889 20:20808981-20809003 CCAGCCTGGGAGACAGAGCAAGG + Intergenic
1172068193 20:32236365-32236387 CCAGCCTGGGAGACAGAGCAAGG - Exonic
1172080778 20:32338965-32338987 CCAGCCTGGGTGACAGAGGAAGG + Intergenic
1172117660 20:32582258-32582280 CCTGCCTGGGAGGCAGAGAAAGG - Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172830310 20:37828478-37828500 CCTAGCTGTGAGACCCTGGAAGG + Intronic
1173585170 20:44176874-44176896 CCTGCAGGGGACACTCTGGATGG - Intronic
1173690255 20:44955274-44955296 CCTGCCTGGAAGAAACTGTAGGG - Intronic
1173867801 20:46323665-46323687 CCTGTCAGGGAGTCACTGGGAGG - Intergenic
1175243170 20:57564547-57564569 GCTGCCTGGGAGTCTCCGGAAGG + Exonic
1175366214 20:58457987-58458009 TCTGCCTGGGAGAAAAGGGATGG + Intergenic
1175406120 20:58730473-58730495 CCAGCCTGGGTGACAGAGGAAGG - Intergenic
1175531823 20:59678791-59678813 CCTGGCTGGGAGCACCTGGAGGG + Intronic
1176158353 20:63635127-63635149 CCAGCCTGGGAGACAGAGCAGGG - Intergenic
1176277282 20:64279615-64279637 TCTGCCTGGGGCACCCTGGAAGG - Intronic
1178311714 21:31535349-31535371 CCAGCCTGGGCGACAGAGGAAGG + Intronic
1178958467 21:37043707-37043729 CCAGCCTGGGCGACACAGCAAGG + Intergenic
1179044885 21:37835085-37835107 CATGCCTGAGAGAGACTGGCAGG + Intronic
1179294176 21:40045851-40045873 CCTGCCCTGGAGACACTGCCAGG - Intronic
1179468299 21:41593067-41593089 GCTGCATGAGAGACAGTGGATGG + Intergenic
1180691385 22:17719122-17719144 CCAGCCTGGGAGACAAAGCAAGG + Intronic
1180981076 22:19878260-19878282 CCTGCCTGGGAGGCATGGGTGGG + Intronic
1180994957 22:19960979-19961001 CCTGGCTGGGGGACACTAGTAGG + Intronic
1181555833 22:23671244-23671266 CCAGCCTGGGGCTCACTGGAGGG - Intergenic
1181675682 22:24450120-24450142 CCTGCCTGAGAGACAAAGGCAGG - Intergenic
1181698545 22:24607407-24607429 CCAGCCTGGGGCTCACTGGAGGG + Intronic
1182007591 22:26973949-26973971 GTTACCTGGGAGTCACTGGAAGG - Intergenic
1182071088 22:27464125-27464147 CCTGCCTGGGGGACTGTGGAGGG + Intergenic
1182644672 22:31798486-31798508 CCAGCCTGGGTGACACAGCAAGG + Intronic
1183339884 22:37274236-37274258 CCAGCCTGTGAGATCCTGGAGGG - Intergenic
1183744270 22:39684369-39684391 TCTGGCTGGCAGACACTGCAGGG - Exonic
1184881036 22:47304336-47304358 CCACCCTGGGAGGGACTGGAGGG + Intergenic
1185012240 22:48320788-48320810 CCTGCCTGGGAGTCCCAGGCAGG - Intergenic
1185032868 22:48453906-48453928 CCTGCGTGGGAGACATGGGGAGG - Intergenic
1185112019 22:48905438-48905460 CCTGGCCAGGAGACACTGCAGGG + Intergenic
1185352687 22:50346288-50346310 ACTGACTGGGGGACACTGAAGGG - Intronic
949575339 3:5333263-5333285 CCTACATAGGAGACACTTGAGGG - Intergenic
949991175 3:9580465-9580487 CCTGCGTGGGAGACAAGGGATGG - Intergenic
950199015 3:11029513-11029535 CCAGCCTGGGAGCCTCTGGAGGG - Intronic
952944524 3:38468916-38468938 CATTCCTGGAAAACACTGGAAGG - Intronic
953216227 3:40921531-40921553 CAGGACTGGGAGAGACTGGAAGG - Intergenic
953460396 3:43077377-43077399 GCTTCCTGGGAGACAGTGGCGGG + Intergenic
953934140 3:47025113-47025135 CCTGCCTAGCAGCCACTGCAGGG + Intronic
953996073 3:47521060-47521082 TCTGTCAGGGAGACACTGGAAGG + Intergenic
954541923 3:51399071-51399093 CCTGCCTGGGAGGCGCTGAAGGG + Intronic
954846255 3:53560170-53560192 CCAGACTGGGTGATACTGGAGGG + Intronic
954935048 3:54318722-54318744 CCAGCCTGGGTGACACAGTAAGG - Intronic
955221973 3:57030391-57030413 CGTGCCTGGAAGACTCTGCAGGG + Intronic
955338694 3:58108041-58108063 CTTCCCTGGGCCACACTGGAAGG + Intronic
955802703 3:62702428-62702450 CAGGCCTGGGAGACTCTGCAGGG + Intronic
957065915 3:75522091-75522113 CCAGCCTGGGTGACAGAGGAAGG - Intergenic
957539803 3:81552485-81552507 CCAGCCTGGGAGACAGAGCAAGG + Intronic
958196987 3:90254039-90254061 CCAGCCTGGGTGACACAGCAAGG + Intergenic
958420400 3:93923870-93923892 CCAGCCTGGGTGACACAGCAAGG + Intronic
959012355 3:101092675-101092697 GCAGCCTGGAAGCCACTGGATGG + Intergenic
959524144 3:107357192-107357214 CCAGCCTGGGAGACAGAGCAAGG + Intergenic
959861363 3:111219037-111219059 CATGGCTGGGAGAGAATGGAGGG + Intronic
960776587 3:121263015-121263037 CCTGACTGGGAGACACTAGCTGG + Intronic
961101019 3:124199127-124199149 CCTGAGTGGGAGACACAGGTTGG + Intronic
961254813 3:125540297-125540319 CCAGCCTGGGCGACAGAGGATGG + Intronic
961445367 3:126978145-126978167 CCCACCTGGGAGACCCTGGGTGG - Intergenic
961612009 3:128147263-128147285 CCAGCCTGGGAAACACAGTAGGG - Intronic
961655562 3:128439770-128439792 GCTGCCCGGGAGGCACTGGGTGG + Intergenic
962461245 3:135615354-135615376 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
962658288 3:137572098-137572120 CATGACTGGGAGACACAGGGCGG + Intergenic
962775613 3:138656798-138656820 CCAGCCTGGGAGACAGAGCAAGG - Intronic
964392686 3:156213919-156213941 CCTCCCTGGTAGACAGTGGATGG - Intronic
965577320 3:170230987-170231009 CCAGCCTGGGTGACAGTGCAAGG - Intronic
965925074 3:173968726-173968748 CCAGCCTGGGCGACAGAGGAAGG - Intronic
966722422 3:183078047-183078069 CCAGCCTGGGAGACACTGCGAGG - Intronic
967030780 3:185604783-185604805 CCAGCCTGGGAGACAGAGCAAGG - Intronic
967540895 3:190666548-190666570 TCTGCCTGGGAAACATTGGAAGG - Intergenic
967941632 3:194770859-194770881 CCTACCTGGGAGACAGTGTAGGG - Intergenic
967942505 3:194777039-194777061 CCTGGTTGAGAAACACTGGAGGG + Intergenic
968184291 3:196621344-196621366 CCAGCCTGGGCGACACAGCAAGG + Intergenic
968407776 4:356199-356221 CCAGCCTGGGTGACACAGCAAGG + Intronic
968839131 4:2988539-2988561 CCAGCCTGGGCGACAGAGGAGGG + Intronic
969201158 4:5607424-5607446 GCAGCCTGGAAGACATTGGAGGG - Intronic
969608938 4:8216470-8216492 GGTGCCTGGGAAACAGTGGAAGG + Intronic
969696788 4:8739532-8739554 CCCGCCAGGGCCACACTGGAAGG - Intergenic
970046019 4:11855257-11855279 CTTCCCTGGGCCACACTGGAAGG - Intergenic
970347868 4:15171023-15171045 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
971069025 4:23069527-23069549 CCTGCCTGGAAAACAATGCAAGG - Intergenic
971420003 4:26466260-26466282 CCTGCCTATGAGCCACTGGAGGG - Intergenic
971943134 4:33241076-33241098 CCTGACTGGGAGACACTTCCTGG - Intergenic
971966410 4:33562669-33562691 CCAGCCTGGGAGACAGCGCAAGG + Intergenic
972515466 4:39806889-39806911 CCAGCCTGGGTGACACAGCAAGG + Intergenic
973635023 4:52854030-52854052 CCAGCCTGGGTGACACAGCAAGG + Intergenic
973888536 4:55346656-55346678 CCGGCCTGGGAGGCCCTGGCGGG + Intronic
975646120 4:76547898-76547920 CCAGCCTGGGTGACAGTGCAAGG + Intronic
976260896 4:83143954-83143976 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
976824047 4:89239689-89239711 CCAGCCTGGGAGACAGGGCAAGG - Exonic
977970360 4:103206279-103206301 CCAGCCTGGGTGACAGAGGAAGG - Intergenic
978061567 4:104345613-104345635 CCAGCCTGGGAGCCACAGGCTGG + Intergenic
978440480 4:108728646-108728668 CCAGCCTGGGCGACAGAGGAAGG + Intergenic
978797770 4:112725388-112725410 CCAGCCTGGGCGACACAGCAAGG - Intergenic
979785771 4:124713073-124713095 CCGGCCTGGAAGACAAAGGAAGG - Intergenic
982079282 4:151771933-151771955 CCTGCCTGAGAGAGGCTGAAGGG - Intergenic
982245681 4:153347968-153347990 GATGTCTGGGAGCCACTGGAGGG + Intronic
982467487 4:155748519-155748541 CCTGCTTGAGAGTCATTGGAGGG + Intergenic
982471019 4:155790545-155790567 CCTGACTGGGAGAAACCGTAAGG - Intronic
982808016 4:159790322-159790344 TCAGCCTGGGACACACTAGATGG + Intergenic
983687500 4:170429098-170429120 TCTGGCTGGGAGGCACTGGTGGG - Intergenic
985749560 5:1666550-1666572 CTTCCCTGGGCCACACTGGAAGG + Intergenic
985820368 5:2156052-2156074 CCTGCCCTGGAGCCGCTGGAGGG - Intergenic
986200449 5:5573967-5573989 GCTGCTTGGGAGACTCTTGACGG + Intergenic
986441584 5:7787239-7787261 CCTGCCTGGGTGACTCAGGGAGG - Intronic
986871605 5:12053893-12053915 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
987131190 5:14861622-14861644 CCAGCCTGGGGGACAGAGGAGGG - Intronic
987579287 5:19768045-19768067 GCAGCCTGGTAGCCACTGGAGGG + Intronic
988486080 5:31669161-31669183 CCTGTCTGGGAGACCCAGGAGGG + Intronic
988852872 5:35196631-35196653 GCAGCCTGGGAGACAGAGGAGGG - Intronic
989789942 5:45386203-45386225 CCAGCATGGGAGACACAGCAAGG - Intronic
990484822 5:56247835-56247857 CCTTCCTGGCAGACTCTGGAGGG + Intergenic
991186244 5:63811794-63811816 CTTCCCTGGGCCACACTGGAAGG - Intergenic
991700877 5:69315224-69315246 CCAGCCTGGGAGACAGAGCAAGG + Intronic
993480740 5:88421824-88421846 CCAGCCTGGGTGACACAGCAAGG - Intergenic
993903595 5:93600748-93600770 CTTCCCTGGGAGACATTCGAGGG - Intergenic
994144775 5:96382795-96382817 GCTACCTGGGTGTCACTGGATGG - Intergenic
995062962 5:107831350-107831372 CCTGCCTGAGAGAGAATGGCCGG + Intergenic
996094926 5:119388666-119388688 CCAGCCTGGGCGACACAGCAAGG - Intronic
996251801 5:121343923-121343945 CCAGCCTGGGAGACAGAGCAAGG + Intergenic
996304421 5:122030396-122030418 GCAGCCTGGCAGCCACTGGAGGG + Intronic
996763165 5:127006171-127006193 CCAGCCTGGGAGACACAGTGAGG + Intronic
997397323 5:133573212-133573234 CCAGCCTGGGAGACAGAGTAAGG + Intronic
997640392 5:135445110-135445132 CCTGCCAAGGAGACCCTGGAGGG - Exonic
997650113 5:135510794-135510816 GCTCCCTGGGAGACACTATAAGG + Intergenic
998367913 5:141642989-141643011 CCTGCCTGGGGGTGAGTGGAAGG - Exonic
998368275 5:141644938-141644960 CCTGCCTGGGCCACACACGAAGG + Exonic
998635901 5:143954422-143954444 CCAGCCTGGGCGACAGTGGGAGG - Intergenic
1000006489 5:157189649-157189671 CCAGCCTGGGCGACACAGCAAGG + Intronic
1000631875 5:163599884-163599906 CCTGCAGGAGAGACACAGGAGGG - Intergenic
1001172744 5:169436418-169436440 CCTGCCTTGGTGAAACTGTATGG + Intergenic
1001454315 5:171848890-171848912 CCTGCCTGGCAGAGACCGGCTGG - Intergenic
1001564526 5:172690836-172690858 CCTGCCAGGGAGACACAGTGAGG + Exonic
1001864225 5:175089267-175089289 CCTGCCTTGGTGATACAGGAAGG + Intergenic
1002030910 5:176429408-176429430 CCAGCCTGGGTGACACAGCAAGG + Intergenic
1002395307 5:178947942-178947964 CCTGCCTGGGTGACACAGCGAGG - Intronic
1002468511 5:179420688-179420710 CCTTCCTGGGTGGCTCTGGATGG - Intergenic
1002965833 6:1965625-1965647 CCAGCCTGGGAAACACAGCAAGG + Intronic
1003044985 6:2725443-2725465 CCAGCCTGGGTGACACAGTAAGG + Intronic
1003483812 6:6557121-6557143 CCAGCCAGGGAGCCACTAGAGGG + Intergenic
1004419988 6:15460732-15460754 CCAGCCTGGGTGACACAGGGTGG - Intronic
1004487829 6:16084171-16084193 CCTGCCTTAGAGCCTCTGGATGG - Intergenic
1004523341 6:16382747-16382769 CTTCCCTGGGCCACACTGGAAGG + Intronic
1004670626 6:17793107-17793129 CCAGCCTGGGTGACAGAGGAAGG - Intronic
1007262107 6:40571165-40571187 CCAGACTGGGAGACCCTTGAAGG + Intronic
1008248024 6:49203214-49203236 GCAGCCTGGAAGCCACTGGAGGG - Intergenic
1009692916 6:67059672-67059694 CCTGCCTGGGTGACAGAGCAAGG - Intergenic
1010056217 6:71568448-71568470 CTTCCCTGGGCCACACTGGAAGG - Intergenic
1010396346 6:75396801-75396823 CCTGACTGGGAGACACTAATAGG - Intronic
1010427431 6:75743000-75743022 CCAGCCTGGGAGACAAAAGAGGG - Intergenic
1011002224 6:82603967-82603989 GCTGCCTGGCAGATACTGTATGG - Intergenic
1012547435 6:100435591-100435613 TCTGTCTGGGAGAGACTGGGAGG - Intronic
1013394278 6:109718946-109718968 CCAGCCTGGGTGACACAGCAAGG - Intronic
1014468361 6:121784110-121784132 CCAGCCTGGGAAACACAGGGAGG - Intergenic
1014749124 6:125235331-125235353 CTTCCCTGGGCCACACTGGAAGG + Intronic
1015593323 6:134843230-134843252 CCTGCCTTGGGGCCAGTGGAAGG - Intergenic
1016167314 6:140962848-140962870 CCAGCCTGGGCGACACAGCAAGG - Intergenic
1016376049 6:143421633-143421655 CCAGCCTGGGTGACACAGCAAGG - Intergenic
1016618696 6:146082183-146082205 CCAGCCTGGGTGACAGTGTAAGG - Intronic
1016888757 6:148984703-148984725 CCAGCCTGGGAAACACAGCAAGG - Intronic
1016975444 6:149803021-149803043 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1016977349 6:149822308-149822330 CCAGCCTGGGTGACAGTGTAAGG + Intronic
1017159852 6:151354699-151354721 CCAGCCTGGGTGACACAGCAAGG - Intronic
1017446420 6:154510600-154510622 CCTGCCAGGGCGGCACGGGAGGG - Exonic
1017474322 6:154772787-154772809 CCAGCCTGGGAGACTCCAGAGGG - Intronic
1017541527 6:155408006-155408028 CCAGCCTGGGTGACACAGCAAGG - Intronic
1017599108 6:156061532-156061554 CTTCCCTGGGAGGCATTGGATGG + Intergenic
1018394084 6:163363982-163364004 CCAGCCTGGGTGACACAGCAAGG - Intergenic
1019070726 6:169342598-169342620 TCAGCCTTGGGGACACTGGAGGG + Intergenic
1019161833 6:170074094-170074116 CCTGCATGTGAGTCACTGCAGGG + Intergenic
1019213686 6:170425880-170425902 CCAGCCTGGGAGCAACTTGAAGG - Intergenic
1019224347 6:170498060-170498082 CCTCTCTGGGAGACTCTGGGAGG - Intergenic
1019429759 7:993245-993267 GTTCCCTGGGAGCCACTGGAGGG + Intergenic
1019991019 7:4691362-4691384 CCAGCCTGGGAGACAGAGGGAGG - Intronic
1020277241 7:6632150-6632172 CCTGCCAGTGAGACACACGAAGG + Intergenic
1020674258 7:11162116-11162138 CCAGCCTGGGAGACAGAGCAAGG - Intronic
1021595145 7:22307491-22307513 ACTGCCTGGGAGACAATTGGTGG + Intronic
1021842043 7:24728698-24728720 CCTGCGGGGGAGACAGTGGGCGG - Intronic
1021878042 7:25066816-25066838 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
1022099280 7:27159561-27159583 CAGGCCTGGGAGACCCTGGGCGG + Intergenic
1022440358 7:30427971-30427993 GCAGCCTGGGAAGCACTGGAGGG - Intronic
1022450612 7:30510823-30510845 CCAGCCTGGGAGACAGAGCAAGG - Intronic
1022656605 7:32324917-32324939 CCGGCCTGGGTGACAGAGGAAGG + Intergenic
1023344753 7:39259896-39259918 CCGGCCTGTGGGACACTGGAGGG + Intronic
1023816473 7:43954295-43954317 CCAGCCTGGGAGACAGAGCAAGG - Exonic
1024389876 7:48796088-48796110 CCTCCCTAGGTGAAACTGGAAGG - Intergenic
1024852007 7:53729793-53729815 CCAGCCTGGGGGACACAGGGAGG - Intergenic
1025203495 7:56977266-56977288 CCAGCCTGGGCGACACAGGGAGG + Intergenic
1025247256 7:57326716-57326738 CCAGCCTGGGTGACACAGCAAGG - Intergenic
1025649903 7:63456936-63456958 CCAGCCTGGGTGACACAGGGAGG - Intergenic
1025668448 7:63599662-63599684 CCAGCCTGGGCGACACAGGGAGG - Intergenic
1025709116 7:63891256-63891278 CCTGAGTGGAAGACACTGAAGGG + Intergenic
1026010554 7:66632455-66632477 CCAGCCTGGGTGACACAGGCTGG + Intronic
1026251173 7:68672266-68672288 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
1026557366 7:71420134-71420156 CCTGCCTCGGAGACACACGATGG + Intronic
1026737707 7:72959700-72959722 CCTGTCTGCGAGACCCTTGAAGG + Exonic
1026847470 7:73705983-73706005 CCTGCCTGAGAGAAGCTGGATGG + Intronic
1026935804 7:74254573-74254595 CCGGCCTGGGAGCGACAGGAAGG + Intergenic
1027106027 7:75405368-75405390 CCTGTCTGCGAGACCCTTGAAGG - Exonic
1029409020 7:100397281-100397303 ACTGCTTGGGAAACACTGCAAGG + Intronic
1029588804 7:101493324-101493346 CCTGCCAGGCAAACACTGAAGGG - Intronic
1029684397 7:102135942-102135964 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1029710138 7:102294948-102294970 CTGGCCTGGGAGGCACTGGGAGG - Intronic
1029731189 7:102439268-102439290 CCTGGCTGCCAGAGACTGGAGGG - Intronic
1030003905 7:105096222-105096244 CCAGCCTGGGTGACAGTGAAAGG + Intronic
1030308685 7:108046960-108046982 CCTGCCTGGGAAACACAGGGAGG - Intronic
1031810864 7:126367391-126367413 CCTGCCTGGGGGACAGAGCAAGG - Intergenic
1032002050 7:128271831-128271853 CTTTTCTGGGAGACACTGGGCGG - Intergenic
1032228605 7:130054513-130054535 CCAGCCTGGGCGACAGAGGAAGG - Intergenic
1032509004 7:132456806-132456828 CCCACCTGGGAGACCTTGGATGG + Intronic
1032845087 7:135745418-135745440 CCTGCCAGGGCACCACTGGAAGG - Intronic
1033247084 7:139726736-139726758 CCTGCATGGGATTAACTGGAAGG + Intronic
1035436254 7:158862228-158862250 ACAGCCTGGGAAACACTGGGAGG + Intronic
1035528430 8:332842-332864 GCTCCCTGGGAGTCCCTGGAGGG + Intergenic
1036028716 8:4941626-4941648 CCAGCCTGGGTGACAGTGCAAGG - Intronic
1036359737 8:8068551-8068573 ACTGCCTGGGAGCCACTCTAAGG - Intergenic
1037316108 8:17600950-17600972 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1037427153 8:18768357-18768379 ACTGCCTGGGAGGCCCAGGAAGG + Intronic
1037676972 8:21059371-21059393 AGTGCCTGGGAGCCACTGGATGG - Intergenic
1038432984 8:27514760-27514782 TCTGCTTGGGAGACACTGGCCGG + Intronic
1039912300 8:41834937-41834959 GCTGCCCGGGAGAAGCTGGAGGG + Intronic
1040313062 8:46246771-46246793 CCTGCCTGGGACAAACCTGAAGG - Intergenic
1040830897 8:51675761-51675783 CCAGCCTGGGCGACACAGCAAGG + Intronic
1042484486 8:69335388-69335410 CCAGCCTGGGAGACACAGGGAGG + Intergenic
1042832661 8:73049016-73049038 CCTGGCTGGGAGACAGGGCATGG - Intergenic
1044673295 8:94704729-94704751 CCAGCCTGGGTGACAATGCAAGG + Intronic
1044867759 8:96589440-96589462 CCAGCCTGGGAGACAGAGCAAGG - Intronic
1046777774 8:118181798-118181820 CCTGCCTGGGAGTTATTAGAAGG + Intergenic
1047957072 8:129984310-129984332 CCTGCCTGGGAGACACTGGATGG - Intronic
1049176172 8:141194011-141194033 CCTGCCAGGGAGAAACGGGAGGG - Exonic
1049373457 8:142278450-142278472 CCTTCCTGGGAGCTGCTGGAAGG - Intronic
1049614175 8:143569064-143569086 CCTGGGAGGGAGAAACTGGAGGG + Intronic
1049614262 8:143569289-143569311 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049614294 8:143569364-143569386 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049820042 8:144627929-144627951 CCTGCCTCGGAGCCAGTGGGGGG + Intergenic
1049826337 8:144671210-144671232 CCTGGCTGGGAGATGCTGCAGGG - Intergenic
1050356080 9:4783740-4783762 CCAGCCTGGGCGACACAGTAAGG - Intergenic
1052343385 9:27384691-27384713 CATGCCAGGGAAATACTGGAGGG - Intronic
1052817015 9:33109605-33109627 CCAGCCTGGGTGACACAGCAAGG + Intronic
1053168693 9:35862914-35862936 CCTGGCTGCGGGTCACTGGAGGG - Intergenic
1055805343 9:80086967-80086989 ACTGGCCGGGAGACACTGGCAGG + Intergenic
1056389760 9:86130133-86130155 CCAGCCTGGGTGACAGAGGAAGG + Intergenic
1057082068 9:92180581-92180603 CCAGTCTGGGAGAGACGGGAAGG + Intergenic
1057215336 9:93224759-93224781 CCTCCCTCCCAGACACTGGAGGG - Intronic
1057459063 9:95242917-95242939 ACTGCCTGGGATTCACTGCAGGG + Intronic
1058580305 9:106449010-106449032 CCAGCCTGGGTGACACAGCAAGG + Intergenic
1058718966 9:107746515-107746537 CCAGCCTGGGCGACAGAGGAAGG - Intergenic
1060243563 9:121925596-121925618 CCTTCCTGGGAGGGTCTGGAGGG - Intronic
1060285437 9:122247569-122247591 CTTGCCATTGAGACACTGGATGG + Exonic
1060415824 9:123429523-123429545 CCAGCCTGGGTGACACAGCAAGG + Intronic
1060479723 9:124011212-124011234 CCCGCCTGGGAGGCCCGGGAAGG - Intronic
1060490726 9:124082228-124082250 CCTGTCTGGGCGACACAGCAAGG + Intergenic
1060520720 9:124292489-124292511 CCTGCATGGAGGCCACTGGATGG + Intronic
1061013344 9:127968115-127968137 CCTGGCTGGGACACCCTGGTTGG + Intronic
1061251621 9:129429641-129429663 GCTGCCGGGGAGACCCTGCAGGG + Intergenic
1061351723 9:130070745-130070767 CCAGCCTGGGAGACAAAGCAAGG - Intronic
1061364148 9:130162402-130162424 CCTGCCTGGGTGACAGAGCAAGG - Intergenic
1061839032 9:133347186-133347208 CCTGCCGCGCAGAGACTGGAGGG - Exonic
1062044055 9:134417097-134417119 CTTCCCTGGGAGCCACTGGCCGG + Intronic
1062189813 9:135242230-135242252 CCTGCCTGGGTGGCCTTGGAGGG - Intergenic
1062337626 9:136079342-136079364 CCTGCCTGGAAGCCAGAGGATGG - Intronic
1062707010 9:137951334-137951356 CCAGGCTGGCAGACACTGGAGGG + Intronic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1185639039 X:1576305-1576327 CCTGCCTGGGAGTCTCTCGAAGG + Intergenic
1185680438 X:1884558-1884580 CCTCCCTGAGAGCCTCTGGAGGG - Intergenic
1186044246 X:5517557-5517579 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
1186191704 X:7073108-7073130 CCTGCCTGGCACACAGTGGGCGG + Intronic
1186612004 X:11146494-11146516 CATGGCTGGGATACACTGGGGGG - Intronic
1186882544 X:13880644-13880666 CCAGCCTGGGAGACAGAGCAAGG + Intronic
1189050908 X:37644547-37644569 CCTGTGTTGGAAACACTGGATGG + Intronic
1189312253 X:40027790-40027812 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
1189731533 X:44025885-44025907 TGTGCCTGGGAAACACAGGAGGG - Intergenic
1190652433 X:52580199-52580221 CCAGCATGGGAGAAAGTGGAAGG - Intergenic
1190878106 X:54474293-54474315 TCTGCCTGTGTGACCCTGGAAGG - Intronic
1192453919 X:71261971-71261993 CCAGCCTGGGCGACAGAGGACGG - Intergenic
1193891178 X:87047617-87047639 GCAGCCTGGCAGCCACTGGAGGG + Intergenic
1194376957 X:93148459-93148481 CCAGCCTGGGAGACAGGGCAAGG + Intergenic
1195136004 X:101907403-101907425 CCTGCCCGGGAATCTCTGGATGG + Intronic
1195993188 X:110703679-110703701 CATGCTTAGGAGACACTGAATGG + Intronic
1196289265 X:113919490-113919512 CCTGCCTGAAACACACTGTATGG - Intergenic
1196654304 X:118201073-118201095 CCAGCCTGGGTGACACAGCAAGG + Intergenic
1196765527 X:119238248-119238270 CCAGCCTGGGCAACACAGGAGGG - Intronic
1197310699 X:124901672-124901694 CCAGCCTGGGCAACACTGGGGGG - Intronic
1197751315 X:129965683-129965705 CCAGCCTGGGAGACAGAGCAAGG - Intergenic
1198321910 X:135526499-135526521 TCTGCCTGGGACACATTGGTTGG + Intronic
1199048398 X:143205497-143205519 CCTCTCTGGGAGAATCTGGAAGG - Intergenic
1199110565 X:143928906-143928928 CCAGCCTGGGCCACAGTGGAAGG + Intergenic
1199984170 X:152938470-152938492 CCTGCCTGAGAGTTCCTGGAGGG - Intronic
1200151593 X:153953964-153953986 CCTGACTGGTGGACTCTGGACGG + Intronic
1201765781 Y:17572451-17572473 CCAGCCTCGGCGACACAGGAAGG + Intergenic
1201835771 Y:18333538-18333560 CCAGCCTCGGCGACACAGGAAGG - Intergenic
1201963470 Y:19707333-19707355 CCTCTCTGTGAGACACTGAAGGG + Exonic