ID: 1047957527

View in Genome Browser
Species Human (GRCh38)
Location 8:129986855-129986877
Sequence TGCCATTACCAGAAGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047957527_1047957540 25 Left 1047957527 8:129986855-129986877 CCAAGCCCCTTCTGGTAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1047957540 8:129986903-129986925 ACCCTCCCCTAATGCTCCAGGGG No data
1047957527_1047957538 23 Left 1047957527 8:129986855-129986877 CCAAGCCCCTTCTGGTAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1047957538 8:129986901-129986923 TAACCCTCCCCTAATGCTCCAGG No data
1047957527_1047957531 -9 Left 1047957527 8:129986855-129986877 CCAAGCCCCTTCTGGTAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1047957531 8:129986869-129986891 GTAATGGCACTGTCTTCCTCTGG No data
1047957527_1047957533 -7 Left 1047957527 8:129986855-129986877 CCAAGCCCCTTCTGGTAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1047957533 8:129986871-129986893 AATGGCACTGTCTTCCTCTGGGG No data
1047957527_1047957539 24 Left 1047957527 8:129986855-129986877 CCAAGCCCCTTCTGGTAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1047957539 8:129986902-129986924 AACCCTCCCCTAATGCTCCAGGG No data
1047957527_1047957543 28 Left 1047957527 8:129986855-129986877 CCAAGCCCCTTCTGGTAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1047957543 8:129986906-129986928 CTCCCCTAATGCTCCAGGGGTGG No data
1047957527_1047957532 -8 Left 1047957527 8:129986855-129986877 CCAAGCCCCTTCTGGTAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1047957532 8:129986870-129986892 TAATGGCACTGTCTTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047957527 Original CRISPR TGCCATTACCAGAAGGGGCT TGG (reversed) Intronic
901941912 1:12668788-12668810 AGGCCTTACCAGAAGGTGCTGGG + Intergenic
904206016 1:28855671-28855693 TTCCATTCCCAGAGGGGGCTGGG - Intronic
904207154 1:28862771-28862793 TCCCAGTACCAGCTGGGGCTGGG - Exonic
906166378 1:43689527-43689549 TGCCAGTAGCAGAAGGAACTTGG + Intronic
907945630 1:59133779-59133801 AGGCATTTCCAAAAGGGGCTGGG + Intergenic
908023200 1:59919894-59919916 TGCCAGTGCCAGAAGGTGCCTGG - Intronic
909340315 1:74524320-74524342 TGCCAGAAACAGAGGGGGCTTGG + Intronic
910322419 1:85962480-85962502 TACCACTACCAGAAGGGTGTGGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
915631535 1:157156492-157156514 TGCCAGAGCCAGAAGGGCCTTGG - Intergenic
915879495 1:159651721-159651743 TGCTATTGCAAGAAGGGACTGGG - Intergenic
917220844 1:172727306-172727328 GGCCATTCCCAGGAGGAGCTGGG + Intergenic
917394808 1:174581940-174581962 TGCCATTACCACAGTGGGGTAGG + Intronic
919132118 1:193464621-193464643 AGCCAGTACCAGAAGGGGGTGGG - Intergenic
921070941 1:211656965-211656987 TCCCATGACCAGAAGGGGCCTGG + Intergenic
921350978 1:214234271-214234293 TGCCATCTCCAGAAGGTGTTTGG - Intergenic
923684332 1:236143225-236143247 TGCCATTCCCAAAAGGGGCAAGG + Intronic
1067430149 10:46237412-46237434 TGCCACTCCCAGAAGGAGATGGG + Intergenic
1067958100 10:50816003-50816025 TACCTCTAACAGAAGGGGCTCGG + Exonic
1071195786 10:83157671-83157693 TGCTATTACCTGAAAGGCCTAGG + Intergenic
1071270578 10:84003088-84003110 TGACATCACCAAGAGGGGCTTGG + Intergenic
1074453560 10:113578559-113578581 TGCCACTCCCAAAAAGGGCTTGG - Intronic
1074556425 10:114495304-114495326 TCCCATTTCCAGTACGGGCTGGG - Intronic
1076033452 10:127178491-127178513 AGCCATTACCAGATGAGCCTGGG + Intronic
1076658580 10:132040188-132040210 TGCCCTTACAAGAAGGGACATGG + Intergenic
1076764769 10:132627070-132627092 TGCCCTTACAAGAAGGGACACGG + Intronic
1077121709 11:911719-911741 CGCCTTTCCTAGAAGGGGCTGGG + Intronic
1078150582 11:8756466-8756488 TGCCATTCTCAGAAGTGGCCTGG + Intronic
1080818642 11:35783733-35783755 TGCCCTTCCAGGAAGGGGCTAGG - Intronic
1081821619 11:46001991-46002013 TGCCATTTCTAGAAGTGGTTCGG + Intronic
1084230281 11:67747356-67747378 AGCCCTTACCAGAAAGGGATTGG + Intergenic
1088547954 11:110980675-110980697 TGCTATTACCAGAAGGAGAGGGG + Intergenic
1089305794 11:117525292-117525314 TGGGATTCCCAGCAGGGGCTGGG + Intronic
1091413401 12:258872-258894 AGCCTATACTAGAAGGGGCTGGG + Intronic
1101843865 12:108346312-108346334 TACCTTTTTCAGAAGGGGCTGGG - Intergenic
1107475593 13:40732790-40732812 TGCCTAACCCAGAAGGGGCTGGG - Intronic
1112590271 13:100757079-100757101 TGGCAGAAGCAGAAGGGGCTCGG + Intergenic
1116430124 14:44836269-44836291 TGCCCTTCCCAGAAGGGGGGAGG + Intergenic
1116799623 14:49429309-49429331 TCCCCTCACCAGACGGGGCTTGG + Intergenic
1119917959 14:78419669-78419691 CACAATCACCAGAAGGGGCTTGG - Intronic
1122238682 14:100347500-100347522 TTCCACTACCAGAAGGAACTAGG + Intronic
1130300136 15:82674313-82674335 TACCACTCCCAGAAGAGGCTGGG + Intronic
1135987958 16:27197981-27198003 TGCCATTACCAGCAGGTGAGTGG + Intergenic
1138194619 16:55043238-55043260 GGGCATCACCAGAGGGGGCTCGG + Intergenic
1138890966 16:61143722-61143744 TCCCATTATCAGGAGGGGGTAGG - Intergenic
1140572313 16:76122121-76122143 TGCTTTTACCAGAAAGGACTGGG - Intergenic
1141985321 16:87576191-87576213 TGCTGTTACCAGAATGGGCTTGG + Intergenic
1142112948 16:88341791-88341813 TGCCATGCCCAGTGGGGGCTGGG + Intergenic
1150160465 17:62893850-62893872 TGCCATTGCCAGAGTGGACTGGG - Intergenic
1150299177 17:64034444-64034466 TGGATTTACCAGAAGGGGCCAGG + Intergenic
1151715136 17:75827459-75827481 GGCCATTACTAGAGGGGGCCTGG - Exonic
1153280294 18:3408607-3408629 TTCTATTATTAGAAGGGGCTGGG + Intergenic
1155308115 18:24498776-24498798 AGCCATTATCAAAAGGGGATGGG + Intergenic
1155416523 18:25605127-25605149 CACCATGAACAGAAGGGGCTGGG + Intergenic
1156369532 18:36460410-36460432 TGCTATTTCAAGCAGGGGCTTGG + Intronic
1157562731 18:48660100-48660122 TGCCATTCCCAGAGGAGCCTGGG - Intronic
1158890907 18:61870969-61870991 TGCCATTATCAGGATGGGGTCGG - Intronic
1160721672 19:600007-600029 TGCCATTAACACTGGGGGCTAGG - Intronic
1161102627 19:2428866-2428888 TGCCCTTAGCTGAAGGGGGTGGG - Exonic
1161205677 19:3040093-3040115 TGCAATGACCAGAAGGCCCTAGG - Intronic
925321702 2:2975299-2975321 TGACAGAACCAGAAAGGGCTGGG - Intergenic
925685104 2:6463075-6463097 TTACTTTACCATAAGGGGCTTGG + Intergenic
927158849 2:20239801-20239823 TGCCAAAACCAGAAGGAACTGGG + Intergenic
927651328 2:24915340-24915362 TACCCTGACCAGAAGGGGCCTGG + Intronic
931564564 2:63601925-63601947 TGCCATGACCAGAAAGAACTGGG - Intronic
933816187 2:86070449-86070471 GGCCAGGACCAGAAGGGCCTAGG - Intronic
935363065 2:102264044-102264066 TGGCATTAAGAAAAGGGGCTGGG - Intergenic
937183969 2:120021906-120021928 TCCCATTACGATAAGGGTCTAGG + Intronic
937869075 2:126774859-126774881 TGCCCCAACCACAAGGGGCTTGG - Intergenic
941425084 2:165333203-165333225 TACCATTACCAGAAGGAGGATGG + Intronic
941770807 2:169343694-169343716 TCCCAGTACCAGAAAGGGTTTGG + Intronic
943528398 2:189047711-189047733 TGCAACTGCCAGAAGGGACTGGG + Intronic
946007793 2:216540353-216540375 TGCCTTTATCAGAAGGTGCCTGG - Intronic
1168815718 20:735349-735371 TCCCAGAACCAGAAGGGGCAAGG + Intergenic
1174364936 20:50050871-50050893 TTCCATTCCCAGAAGGGGCCTGG - Intergenic
1181236683 22:21451205-21451227 TGCCCTTCCCAGAAGGGGGGAGG + Exonic
1181671233 22:24426483-24426505 GGCCATTGACAGGAGGGGCTTGG + Intronic
1182366434 22:29782462-29782484 TGCCATTCAGAGCAGGGGCTAGG - Intergenic
949873344 3:8607778-8607800 TGCCATTTCCAGAAGCGGAGGGG - Intergenic
951626454 3:24669506-24669528 TGCTTTTAGCAAAAGGGGCTTGG + Intergenic
957046851 3:75382389-75382411 AGCCCTTACCAGAAAGGGATTGG + Intergenic
961878918 3:130046457-130046479 AGCCCTTACCAGAAAGGGATTGG + Intergenic
962238530 3:133730269-133730291 TGCCATTTCCAGAAGGAGTGAGG - Intergenic
964224484 3:154382308-154382330 TGCCATTCCCTGAAGTAGCTGGG - Intronic
966021525 3:175217560-175217582 GGCAATTACCAGAAGTTGCTTGG + Intronic
968798081 4:2722473-2722495 TGCTGTGTCCAGAAGGGGCTGGG + Intronic
969824198 4:9744029-9744051 AGCCATTACCAGAAAGGGATTGG - Intergenic
970569931 4:17369691-17369713 TGCCATTAGCAAAAGGAGATTGG - Intergenic
974629526 4:64466082-64466104 GGCCTTTGCCAGAAGAGGCTGGG - Intergenic
975676634 4:76833618-76833640 TGCTATTACCAGAAGAAGGTGGG - Intergenic
984836797 4:184029857-184029879 TACAATAAACAGAAGGGGCTGGG + Intergenic
992178356 5:74172822-74172844 TTCTATTAACAGAAGGGGATTGG + Intergenic
994323676 5:98423586-98423608 TGCCATCTTCAGAAGGGGTTGGG - Intergenic
994808032 5:104477633-104477655 TTCCATTACAAGTAGGGGATGGG + Intergenic
995834860 5:116389876-116389898 TGCCATTTCTAGGAGGGGGTGGG + Intronic
995926413 5:117380315-117380337 TGCCATCACCAAAAGCAGCTGGG - Intergenic
1001575255 5:172759092-172759114 TGCCATGACTAGAAGGGAGTCGG - Intergenic
1001752325 5:174141103-174141125 TGCCAGTGCCAGCAGGGGCCTGG - Intronic
1002639507 5:180624063-180624085 TGCCAGGACCAGAAGAGGCAAGG + Intronic
1008208060 6:48687072-48687094 TCCCACTGCCAGAAGGGGCAGGG - Intergenic
1017994903 6:159523500-159523522 TGCCATGACCTTAAGGGGGTGGG - Intergenic
1019047986 6:169162729-169162751 TGCGTGTACCAGAGGGGGCTGGG + Intergenic
1032785239 7:135195129-135195151 TGGCATTAGCAGAAGAGGATGGG - Intronic
1035309519 7:157956421-157956443 TGACTCTACCAGAAGAGGCTGGG + Intronic
1038373673 8:27016429-27016451 TCCCATTAGCAGCAGGGCCTGGG + Intergenic
1038535511 8:28350266-28350288 TGCAATGACCAGAAAGAGCTGGG + Intronic
1039139444 8:34369369-34369391 TGCTTTTAACAGAAGGGGCATGG + Intergenic
1040569603 8:48596137-48596159 TGCCATTTCCAGAGGAGGCGTGG + Intergenic
1040868868 8:52079475-52079497 TTCCATTAGGAGAAGGGTCTTGG + Intergenic
1047019053 8:120755361-120755383 TGGTATTAACAGAAGTGGCTTGG + Intronic
1047957527 8:129986855-129986877 TGCCATTACCAGAAGGGGCTTGG - Intronic
1048374404 8:133810329-133810351 TGACATTCCCAGAAAGGCCTAGG + Intergenic
1049403631 8:142442052-142442074 GGCCATTACCAGAAGTGGCCAGG - Intergenic
1053161167 9:35814497-35814519 TGCACTTGCCAGAAGCGGCTCGG - Intronic
1055058664 9:72046858-72046880 TGGCATTCCCAGTAGGGGGTGGG - Intergenic
1055379260 9:75688536-75688558 TCCCATTAGCAGATGGGGCCTGG + Intergenic
1057192109 9:93094123-93094145 TACCTTTCCCAAAAGGGGCTGGG + Intergenic
1058737274 9:107905238-107905260 TGCCAACCACAGAAGGGGCTAGG - Intergenic
1060542572 9:124440786-124440808 TCCCACTGCCAGGAGGGGCTGGG + Intergenic
1190629862 X:52376008-52376030 TGAAATTAACAGAAGAGGCTGGG - Intergenic
1200912634 Y:8544625-8544647 TCCCATTATCAGAAGGAGCATGG - Intergenic