ID: 1047959677

View in Genome Browser
Species Human (GRCh38)
Location 8:130001847-130001869
Sequence CCTTCCAGGCAAACAGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047959677_1047959681 24 Left 1047959677 8:130001847-130001869 CCATCAGCTGTTTGCCTGGAAGG 0: 1
1: 0
2: 3
3: 21
4: 190
Right 1047959681 8:130001894-130001916 TGTGACCTCCCTCTGACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047959677 Original CRISPR CCTTCCAGGCAAACAGCTGA TGG (reversed) Intronic
901149486 1:7091614-7091636 CCTTCCAAGCACCCGGCTGAAGG - Intronic
901484068 1:9546134-9546156 CCTTCACAGCAAACATCTGAAGG - Intronic
901654381 1:10760997-10761019 CCTGCCAGCCAATCAGCAGATGG + Intronic
904390484 1:30182356-30182378 CCTTCCACACAAACACCTCAAGG - Intergenic
905010594 1:34744533-34744555 TCTTCCAGGCAAGAAGATGAAGG - Intronic
905970479 1:42138099-42138121 CCTCCCTGGCACAGAGCTGAGGG - Intergenic
909330663 1:74406170-74406192 CCTTTCTGGCTATCAGCTGAAGG + Intronic
914235662 1:145808984-145809006 CCTTTCAGATAAACAGCTGATGG - Intronic
915529185 1:156493686-156493708 CCTTGCTGGCAAAAATCTGAGGG - Intronic
917430757 1:174965907-174965929 CCTTACAGACACACAGCTAAAGG - Intronic
918740006 1:188117759-188117781 CCTTCCAAGAAAACAGCTGAGGG - Intergenic
921269546 1:213455201-213455223 CCTTGCAGGGAAACAGATGTAGG - Intergenic
921899266 1:220433165-220433187 CATTCCGGGCACACAGCTGGGGG + Intergenic
922609900 1:226918753-226918775 CTTCCCAGGCACACAGCTGGGGG + Intronic
923010614 1:230084706-230084728 CCCAGCAGGCAAACAGCTGAAGG - Intronic
923057492 1:230438053-230438075 ATTTCCAGGGAAACTGCTGATGG + Intergenic
1062964977 10:1600220-1600242 CATCCCAGGCAAACACCTAATGG - Intronic
1063166674 10:3469765-3469787 CTTTCCTGTGAAACAGCTGAAGG + Intergenic
1063986973 10:11514951-11514973 CCTTCCCTGAAAACAGCTCATGG - Intronic
1064239765 10:13615832-13615854 CCCTCCAGTCGAATAGCTGAAGG - Intronic
1064272137 10:13875113-13875135 TCACCCAGGCAAAGAGCTGAAGG + Intronic
1064327360 10:14363835-14363857 GCTTCCTGGGAGACAGCTGACGG - Intronic
1064886371 10:20117485-20117507 CATTCAAGGCAGACAGTTGATGG + Intronic
1066003521 10:31126795-31126817 CCCCACAGGCTAACAGCTGAGGG + Intergenic
1070268363 10:74926844-74926866 CTTTCCCAGGAAACAGCTGAAGG + Intronic
1071542053 10:86494453-86494475 ACTTCAAGGAAAACAACTGATGG - Intronic
1076209231 10:128627197-128627219 GCTTCCCTGCAAGCAGCTGATGG - Intergenic
1076220254 10:128728088-128728110 ACTTCCAGACACAGAGCTGAAGG - Intergenic
1076483772 10:130802527-130802549 CTCTCCAGGCAAACACCTGCGGG - Intergenic
1076849103 10:133084268-133084290 CCTTCCAAAGAAACAGCTGCTGG - Intronic
1077485528 11:2836821-2836843 CCTGCCAGGTAACCAGCTTAGGG - Intronic
1078447303 11:11413886-11413908 CCTGCCTGTGAAACAGCTGAGGG - Intronic
1078935580 11:15946697-15946719 CCATCCAGGGACAAAGCTGAGGG - Intergenic
1080510247 11:32962818-32962840 CATTCAAGGAAAACAACTGATGG - Intronic
1081781620 11:45716921-45716943 CCTTCCAGGGCAATAGGTGAGGG - Intergenic
1083028583 11:59571583-59571605 CTTTAAAGGCAAAAAGCTGAAGG - Intergenic
1084379699 11:68803875-68803897 CCTACCAGGCACACCGCTGAAGG + Intronic
1085528881 11:77180017-77180039 ACTTCCTGGCCAACACCTGAGGG - Intronic
1089327008 11:117664166-117664188 CGTTTCAGACAAACAGCTCAGGG + Intronic
1093403429 12:18776371-18776393 CCTTCCAGGGAAACAACTGGTGG - Intergenic
1095998643 12:48111012-48111034 ACTTCCAGGAAAAAAGCTCAGGG + Intronic
1096541799 12:52312190-52312212 CCTTCCACCCAACCAGCTCAAGG - Intergenic
1099368740 12:81803144-81803166 ACTCCCAGCCAAACACCTGATGG - Intergenic
1100668041 12:96777019-96777041 ACTTCCAGGGAAACAACTGACGG - Intronic
1102320106 12:111925955-111925977 TCTTCCATGAAAACAGCAGAAGG + Intergenic
1102706180 12:114882681-114882703 CCTCACAGCCAAACAGCTGGTGG - Intergenic
1104461807 12:128962442-128962464 ACTTCCTGGCAAACAGGTGTGGG + Intronic
1104638425 12:130452019-130452041 CCTTCCAGGCAACCAGGACAGGG - Intronic
1104675170 12:130707519-130707541 CCTTCCAGACAAAGACATGAAGG + Intronic
1106669447 13:31888952-31888974 ACTTACAGGCAAACAGACGATGG - Intergenic
1107289012 13:38830864-38830886 CCTCCCAGACTAGCAGCTGAAGG + Intronic
1113589484 13:111488470-111488492 CCTTCCATGCAAAGATGTGAAGG - Intergenic
1113818417 13:113192538-113192560 ACTTCCAGGCAAACAACTGATGG + Intronic
1116700584 14:48236589-48236611 TCTTTCAGGTAAACAGCTCAGGG + Intergenic
1117015199 14:51510761-51510783 CCTCCAAGGCTAACACCTGAAGG + Intronic
1117459131 14:55927308-55927330 CTTTCCAGGAAAGCAGCTGCTGG - Intergenic
1118021500 14:61720534-61720556 CCTCACACGCAAATAGCTGATGG - Exonic
1118978346 14:70696336-70696358 CTTGCCAGGCAAAAAGATGAAGG - Intergenic
1119401448 14:74365389-74365411 CCTGCCAGGCAGAGAGCTGGGGG + Intergenic
1120702694 14:87715226-87715248 CCTTCCAGTCGAAGAGCTGGGGG + Intergenic
1121113532 14:91328511-91328533 CCAGCCCAGCAAACAGCTGAGGG + Intronic
1121519742 14:94577821-94577843 TCATGCAGGCAAACAGATGATGG + Intronic
1121876230 14:97456082-97456104 CTTTCCTGGCAAACAGCTGGTGG + Intergenic
1122113754 14:99517797-99517819 CCTTCCAGGCAGGAAGCTGGGGG - Intronic
1124104836 15:26728134-26728156 TCCTCCAGGGAAACAACTGAGGG + Intronic
1125325075 15:38528078-38528100 CCTTCCATGCTAACAGGAGAGGG - Intronic
1125391357 15:39196194-39196216 CCTTCCAGGGAAATAGCTATGGG - Intergenic
1126431361 15:48588795-48588817 CCTTCCTGGGAAACTGGTGAAGG + Intronic
1127531037 15:59843778-59843800 CCCTCCAGGCTAACAGGTGTGGG + Intergenic
1127713076 15:61620615-61620637 CCTTTCACCCAAACATCTGAGGG - Intergenic
1129277246 15:74454276-74454298 CCCTCCAGCCAAAGAGCTGAGGG + Intronic
1129679092 15:77647832-77647854 CCTTCCAGGAAAAGTGCTGAGGG - Intronic
1132107801 15:99076557-99076579 CCTTGCAGCCAAACAACAGAGGG + Intergenic
1133255734 16:4514616-4514638 CCATCCAGGCCAGCAGCTGAAGG - Exonic
1135263999 16:21005887-21005909 ACTTCCAGGTAAATATCTGATGG - Intronic
1139896874 16:70294737-70294759 CCTGTCAGCCAATCAGCTGAGGG - Intronic
1139936047 16:70571953-70571975 CATTCCAGGAGAAGAGCTGAGGG - Exonic
1141950107 16:87334569-87334591 CCTTTCAGGCAGACAGATGTGGG - Intronic
1142201402 16:88762678-88762700 ACTTCCTGGCACACAGCTCAGGG - Intronic
1144600609 17:16609250-16609272 ACTTCCAGCCACCCAGCTGACGG - Intergenic
1145104257 17:20102247-20102269 CCTTCAAAACAAACAGCTGAAGG - Intronic
1145755235 17:27385402-27385424 CCTTCCAGGCAGAAAGATGAGGG - Intergenic
1146511417 17:33452381-33452403 GCTGCCAGGCAAAGAGGTGATGG - Intronic
1147152871 17:38528386-38528408 CCTTCCAGGCGTGCAGCGGATGG + Intergenic
1147165710 17:38592117-38592139 ACTTGCAGGGAAGCAGCTGAGGG - Intronic
1147952868 17:44116705-44116727 CCCTCCTGGGAAACTGCTGAGGG + Intronic
1150144337 17:62755218-62755240 TCTTCCTGGCACACAGCTCAGGG + Intronic
1150288102 17:63965439-63965461 CCTTCCCTGCAAACAGTAGAAGG + Intronic
1152457409 17:80424170-80424192 CCATCCAGTGAAACAGCTGGGGG - Intronic
1152485979 17:80593171-80593193 ACTTCAAGGAAAACAACTGATGG + Intronic
1158675873 18:59517762-59517784 CCTTCCAGCCTAACTGCTAATGG - Intronic
1159057861 18:63484237-63484259 ACTTCCAGGCAAATGTCTGAAGG - Intronic
1159118396 18:64140966-64140988 CCTTGCTGGCTGACAGCTGAGGG - Intergenic
1164149389 19:22536404-22536426 GTTTCCAGGTAAACAGCTGCTGG - Intergenic
1164618022 19:29678229-29678251 GCTTCCAGGCTGACAGCCGAGGG + Intergenic
1165776874 19:38409879-38409901 ACTTCCAGGGAAAAAGATGACGG + Exonic
1167406384 19:49311297-49311319 CCTTGCTGGCAAACACCTCATGG - Exonic
927607026 2:24494616-24494638 TCTGCCAGGAAAGCAGCTGATGG - Intronic
929597459 2:43185344-43185366 ACTTCCAGGAAAACAGCAGAAGG + Intergenic
929619652 2:43341784-43341806 ATTACCTGGCAAACAGCTGAGGG + Intronic
933456013 2:82520246-82520268 CCCACCAGCCACACAGCTGATGG + Intergenic
933815934 2:86068848-86068870 CCTTCGTGGCAGACGGCTGATGG + Intronic
934053100 2:88226637-88226659 CCTTCCAGGCAACCAGCATTCGG - Intergenic
935011250 2:99138225-99138247 CATTTCAGCCAAAGAGCTGAGGG - Intronic
935214011 2:100961877-100961899 CCTTCCAAACAAACTTCTGAGGG - Intronic
935340954 2:102059428-102059450 GATTCCAGGCACACAGCTGTTGG - Intergenic
938115210 2:128597749-128597771 CCTTCCAGGCTTATAGCTCAAGG - Intergenic
938210441 2:129462278-129462300 CATTGCAGGCACACAGCAGAGGG + Intergenic
939368435 2:141265380-141265402 CCTTCCAGGGCAGCAGTTGAAGG - Intronic
943430363 2:187792488-187792510 CCTTCCAGGAAAACTTCTGTTGG + Intergenic
944187496 2:196965679-196965701 ACTTCAAGGAAAACAGCTCACGG - Intergenic
944597683 2:201276353-201276375 GCTTCGTGGCTAACAGCTGAGGG - Intronic
946080227 2:217112197-217112219 GCTGCCAGGCAACCAGCTGCTGG - Intergenic
947803868 2:232951079-232951101 CTTTCCTAGCAAAAAGCTGAAGG - Intronic
948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG + Intergenic
1169210861 20:3765674-3765696 CCTTCTTGGAAAACAGCTCAAGG + Intronic
1172092954 20:32446596-32446618 CCGTCCTGTCAAGCAGCTGAGGG + Exonic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172865718 20:38095540-38095562 CCTTCCAGGGACACAGCAGTGGG - Intronic
1176386975 21:6142988-6143010 CCCTCCAGGCCACCAGCGGAGGG - Intergenic
1177282688 21:19004155-19004177 ACTTGCAGGCTAGCAGCTGAGGG - Intergenic
1177459993 21:21397303-21397325 CCTTCTGGGCAGAAAGCTGAGGG - Intronic
1178154167 21:29832210-29832232 CAGTCCAGGAAAGCAGCTGAGGG - Intronic
1179605929 21:42514863-42514885 CCTTCCAGGCAAAGAGCTAAGGG - Intronic
1179736498 21:43395264-43395286 CCCTCCAGGCCACCAGCGGAGGG + Intergenic
1180089920 21:45528632-45528654 CCTTCCAGGAATCCACCTGAGGG + Intronic
1183921544 22:41173394-41173416 TCTTCTAGGCAAAAAGCTAAAGG + Intronic
1184252357 22:43268019-43268041 CCTTCCAAGCTCACAGCAGAGGG - Intronic
1184252567 22:43269105-43269127 CCTTCCAGGCAAGCAGACGGAGG + Intronic
1184292623 22:43506176-43506198 AATGCCAGGCAAACAGCTGTGGG - Exonic
1184689658 22:46111796-46111818 CCTTCCTGGGGAAAAGCTGAGGG - Intronic
1185122368 22:48979615-48979637 TATTCCAGGCCAATAGCTGAAGG + Intergenic
1185156532 22:49196440-49196462 CCTGCAAGGCACAGAGCTGAAGG + Intergenic
949124710 3:433409-433431 CCTTCCAGAGAACCAGCTGCAGG + Intergenic
950172105 3:10845910-10845932 TCTTCCAGGAAAAAAGCTGGAGG + Intronic
951861129 3:27253923-27253945 CATTCCAGGCAGAGAGCTGGAGG - Intronic
951881757 3:27486377-27486399 ACTTGCTGGCAAACAGCTGGAGG + Intergenic
953787870 3:45924193-45924215 TCTTCCAGGCACAAAGCTGCTGG + Intronic
954660062 3:52222245-52222267 CCTGGCAGGAAACCAGCTGAAGG - Exonic
956058285 3:65323585-65323607 TTTTCTAGGCAAACAACTGAGGG - Intergenic
956153382 3:66267441-66267463 AGTCCCTGGCAAACAGCTGAGGG - Intronic
956757216 3:72400736-72400758 CTTTCTAGGCAAGCAGCAGAAGG - Intronic
962309498 3:134315066-134315088 CCTTTCAGCTAATCAGCTGAAGG - Intergenic
967940253 3:194760662-194760684 TCTTCCAGGAAAACAACTGATGG - Intergenic
968982131 4:3855958-3855980 CCTGCCAGGGCAACAGTTGAAGG - Intergenic
969442619 4:7226375-7226397 CCTTCCAGGGCAGGAGCTGATGG + Intronic
971331498 4:25685260-25685282 GCTTCCAGGGACATAGCTGAGGG + Intergenic
972968266 4:44539655-44539677 ACTTCCAGTAATACAGCTGAGGG + Intergenic
974594446 4:63998066-63998088 CCTTCCAGGTAAACAACAAAAGG - Intergenic
975548346 4:75584337-75584359 CCTTGCTGGCTAACAGCTGGGGG - Intronic
976392007 4:84515545-84515567 CCTTGCAGCCACAGAGCTGAGGG + Intergenic
979129525 4:117024332-117024354 CCTTCCAGGCAAGTAGCAGGTGG + Intergenic
982102123 4:151978276-151978298 CCTTCTTTGCAAACAGATGAGGG - Intergenic
982164813 4:152604872-152604894 CCTGCCAGGCAAACAGCCCATGG + Intergenic
982198606 4:152938115-152938137 CCTTCCAGGAAGACAACTGTGGG - Intronic
982808505 4:159796466-159796488 CCTTCCAGTCAAATAGGAGAAGG - Intergenic
986672939 5:10159193-10159215 CCTGCCAATCAAACAGCTCAGGG + Intergenic
992175579 5:74146181-74146203 ACATCCAGGCAAACAGCCCAGGG + Intergenic
993581167 5:89662663-89662685 CCTGCCAGGCAAACAGCCAGAGG - Intergenic
997267259 5:132502092-132502114 ACTTCCTGGCTCACAGCTGAAGG - Intergenic
997848259 5:137307785-137307807 CCTTCCAGGCAAAGTCCTCAAGG - Intronic
1003303253 6:4903870-4903892 TCTCCCAGGCAGACGGCTGATGG - Intronic
1004423029 6:15488315-15488337 TCCTGCAGGCACACAGCTGAGGG + Intronic
1005938823 6:30545907-30545929 TGTTCCAGGCTAACAGCTGTGGG - Exonic
1007568269 6:42870164-42870186 CCTCCCATACACACAGCTGAGGG - Intergenic
1008827726 6:55718561-55718583 CCATCCAGGCACAAAACTGAGGG - Intergenic
1011725537 6:90206707-90206729 CCTTCCTGGGCACCAGCTGATGG - Intronic
1014048051 6:116916830-116916852 CCTTCTAGGCAAACATTTAATGG + Intronic
1016640677 6:146345247-146345269 AATTCTAGGAAAACAGCTGAAGG + Intronic
1016878770 6:148889599-148889621 CCATTGAGGAAAACAGCTGATGG - Intronic
1017041954 6:150315106-150315128 CCTTCCAAGGAAACAGCTGCAGG + Intergenic
1017295994 6:152795465-152795487 CTTTCAAGGCTAACTGCTGATGG - Intergenic
1018757852 6:166864926-166864948 CCTTGCATGTAAAAAGCTGATGG - Intronic
1022444669 7:30460395-30460417 TCTTCCAGGCAAAGAGAGGACGG + Intronic
1023720698 7:43090875-43090897 CTTTCCAGGCATACAGCAGCAGG + Intergenic
1024206648 7:47168351-47168373 TCTTTTAGGCAAACAGCTGATGG + Intergenic
1024980560 7:55154291-55154313 CCGTCCAGGCACACAGGCGAGGG + Intronic
1027860980 7:83580751-83580773 CCTTCAAGGCAAATAGGAGAGGG - Intronic
1030523226 7:110623592-110623614 CCTTTCACCCACACAGCTGAAGG + Intergenic
1034237741 7:149585805-149585827 GTTTCCAGGCAAATGGCTGAAGG + Intergenic
1034240814 7:149609461-149609483 GTTTCCAGGCAAATAGCTGAAGG + Intergenic
1034245781 7:149643361-149643383 GTTTCCAGGCAAATAGCTGAAGG + Intergenic
1034989920 7:155541929-155541951 CCTTCCAGGTAAACAGCCCTGGG - Intergenic
1035256724 7:157633807-157633829 CCTTGCAGGCCAACAGCTCCTGG - Intronic
1036885172 8:12546844-12546866 CTTTGCAGTCAAACAGCTGGAGG - Intergenic
1037362064 8:18084274-18084296 CCTTCCAGGCTACCTGCAGAAGG + Intronic
1037621422 8:20566785-20566807 CCTTCCAGGCAAGTGGCTGGAGG - Intergenic
1037993563 8:23337583-23337605 CCAACCAGGCAAACCGCTGGAGG + Intronic
1039346504 8:36711103-36711125 CTTTCAAGGCATACAGCAGAAGG - Intergenic
1039487787 8:37925165-37925187 TATTCAAGACAAACAGCTGAAGG - Intergenic
1043769263 8:84177403-84177425 CCCTGAAGCCAAACAGCTGAGGG + Intergenic
1043775681 8:84265474-84265496 CCTTCCTGGCTGTCAGCTGAGGG - Intronic
1045320691 8:101079864-101079886 CCTTCTGGGCAAGGAGCTGATGG - Intergenic
1047258721 8:123236965-123236987 ACTTGCGGGCAAACAGCTGGAGG + Intronic
1047959677 8:130001847-130001869 CCTTCCAGGCAAACAGCTGATGG - Intronic
1048733332 8:137469128-137469150 CCTTCAAGAAAAACAGCGGAAGG - Intergenic
1049755804 8:144310876-144310898 CCATCCTGGCAAACACCTGGAGG - Intronic
1050334340 9:4576116-4576138 TCTTCCAGGTAAACAGAAGAGGG + Exonic
1051944024 9:22544004-22544026 CCTTCCTGGAAAATAGATGATGG + Intergenic
1055641394 9:78321240-78321262 CTTTCCAGGCAGGCAACTGAGGG - Intronic
1056506851 9:87265722-87265744 CCTTCCAGGCTCCCTGCTGAAGG + Intergenic
1056946920 9:91005472-91005494 CATCCCAGGAAAACAGATGAGGG - Intergenic
1060594559 9:124840439-124840461 CCCTCCAAGGAGACAGCTGACGG - Intergenic
1061443884 9:130626534-130626556 CCCTCAAGCCAAACAGCTGAGGG - Intronic
1061505865 9:131031583-131031605 CATTCCAGGGATACAGCTGGGGG - Intronic
1061777342 9:132974214-132974236 TTTTCCAGGCACACAGCTCAGGG - Intronic
1062190321 9:135244707-135244729 CCATCCAGGCAAAGCCCTGACGG + Intergenic
1186815375 X:13232215-13232237 CCTTTCAACAAAACAGCTGATGG - Intergenic
1187298207 X:18023157-18023179 CCATCCAGACACAAAGCTGATGG + Intergenic
1189348534 X:40260415-40260437 ACTTCTAGGAAAACAGCTAATGG - Intergenic
1190562075 X:51695930-51695952 CCTTCCAAGCAAATTGCGGAAGG + Intergenic
1194962122 X:100247778-100247800 TCTTCTAGGCACACAGCTGAGGG - Intergenic
1195965300 X:110424624-110424646 CCTTCCAGGCAGACAGCTATGGG + Intronic
1199243972 X:145581422-145581444 CCTTACAGGGAAACACGTGAAGG - Intergenic
1199430831 X:147757856-147757878 CCTTCTATGCCAACAGCTGTGGG - Intergenic