ID: 1047962528

View in Genome Browser
Species Human (GRCh38)
Location 8:130021309-130021331
Sequence ATGGACCCATGGGGAAAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047962521_1047962528 20 Left 1047962521 8:130021266-130021288 CCATCGTTGTTGTTACTATACGG No data
Right 1047962528 8:130021309-130021331 ATGGACCCATGGGGAAAACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047962528 Original CRISPR ATGGACCCATGGGGAAAACC GGG Intergenic
No off target data available for this crispr