ID: 1047964585

View in Genome Browser
Species Human (GRCh38)
Location 8:130036470-130036492
Sequence TAACCCCAAACTCAGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047964585_1047964591 26 Left 1047964585 8:130036470-130036492 CCAGTCTCCTGAGTTTGGGGTTA No data
Right 1047964591 8:130036519-130036541 ATGTAAAAATTTGCAGATCTTGG No data
1047964585_1047964587 2 Left 1047964585 8:130036470-130036492 CCAGTCTCCTGAGTTTGGGGTTA No data
Right 1047964587 8:130036495-130036517 TATCCCAATGTTTCCATAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047964585 Original CRISPR TAACCCCAAACTCAGGAGAC TGG (reversed) Intergenic
No off target data available for this crispr