ID: 1047968239

View in Genome Browser
Species Human (GRCh38)
Location 8:130063418-130063440
Sequence AAAGCCAGGAGTGCGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 299}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047968239_1047968246 23 Left 1047968239 8:130063418-130063440 CCTCTCTCCGCACTCCTGGCTTT 0: 1
1: 0
2: 2
3: 36
4: 299
Right 1047968246 8:130063464-130063486 ACCAGTCTGAGACCCTTGAGGGG No data
1047968239_1047968243 -1 Left 1047968239 8:130063418-130063440 CCTCTCTCCGCACTCCTGGCTTT 0: 1
1: 0
2: 2
3: 36
4: 299
Right 1047968243 8:130063440-130063462 TGGTGTGACAATGTGACTGTTGG No data
1047968239_1047968245 22 Left 1047968239 8:130063418-130063440 CCTCTCTCCGCACTCCTGGCTTT 0: 1
1: 0
2: 2
3: 36
4: 299
Right 1047968245 8:130063463-130063485 CACCAGTCTGAGACCCTTGAGGG No data
1047968239_1047968248 29 Left 1047968239 8:130063418-130063440 CCTCTCTCCGCACTCCTGGCTTT 0: 1
1: 0
2: 2
3: 36
4: 299
Right 1047968248 8:130063470-130063492 CTGAGACCCTTGAGGGGAAGAGG No data
1047968239_1047968244 21 Left 1047968239 8:130063418-130063440 CCTCTCTCCGCACTCCTGGCTTT 0: 1
1: 0
2: 2
3: 36
4: 299
Right 1047968244 8:130063462-130063484 GCACCAGTCTGAGACCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047968239 Original CRISPR AAAGCCAGGAGTGCGGAGAG AGG (reversed) Intronic
900503146 1:3016428-3016450 AAAGGAAGGAGGGAGGAGAGAGG + Intergenic
900503173 1:3016531-3016553 AAAGGAAGGAGGGAGGAGAGAGG + Intergenic
900651067 1:3730313-3730335 ACAGCCAGGAGTGGGCAGAGAGG - Intronic
901706399 1:11076703-11076725 AAACCCAGCAGTGCTGGGAGAGG - Intronic
902153210 1:14461673-14461695 AAAGCCAGCACTGCCGAGAGGGG + Intergenic
902728138 1:18350873-18350895 CAGGCCAGGAGTGCGGTGGGGGG + Intronic
903293992 1:22332188-22332210 AAGCCCAGGACTGGGGAGAGAGG - Intergenic
908736056 1:67278069-67278091 AATTCTAGGAGTGTGGAGAGAGG + Intergenic
911381572 1:97121367-97121389 AAAGTCAGAAGTGCCAAGAGGGG - Intronic
916983901 1:170169730-170169752 AAAGCCAGGTCAGGGGAGAGGGG - Intergenic
917021242 1:170590741-170590763 AAAGCCAGGAAGGCGGGAAGGGG + Intergenic
917493681 1:175520703-175520725 ATAGCCAGAAGGGAGGAGAGAGG - Intronic
919785522 1:201255583-201255605 GTAGCCAGGAGAGAGGAGAGCGG + Intergenic
919961824 1:202478111-202478133 AAATCAAGGAGTGTGGAGTGAGG + Intronic
920191577 1:204197190-204197212 AGTGCCAGGGGTGCAGAGAGGGG + Intergenic
920389687 1:205591691-205591713 AAAGCCAAGAGTGCACAGACAGG - Intronic
922025334 1:221743417-221743439 AAAGTCAGGGGAGCGGGGAGAGG - Intergenic
922748555 1:228060346-228060368 AAAGCCAGGCGCTTGGAGAGGGG - Exonic
924588934 1:245385039-245385061 AAAGAGAGGAGTGAGGTGAGGGG - Intronic
924818427 1:247463458-247463480 GAAGCCAGAAGTGTGGAGAGTGG + Intergenic
1063666077 10:8061505-8061527 ACAGGCAGGGGTGAGGAGAGGGG + Intronic
1064822703 10:19356292-19356314 AAAGCCAGAAGTGGGAATAGTGG + Intronic
1066290488 10:34010038-34010060 ACAGCCTGAAGTGCAGAGAGAGG + Intergenic
1068167015 10:53343295-53343317 AAAGCCAGCATTGTAGAGAGAGG - Intergenic
1068636527 10:59354262-59354284 AAAGCCAGGAAAGGGGAGAGGGG + Intronic
1069849192 10:71394105-71394127 GGAGCCAGGAGTCCGGAGAGCGG - Intergenic
1072342317 10:94464837-94464859 AAAACAAGTAGTGGGGAGAGTGG + Intronic
1072654640 10:97321249-97321271 AAAGCCCGGAGCGCGGCCAGGGG - Exonic
1073422773 10:103437903-103437925 ATAGGCAGGAGTGAGGAGACAGG - Intronic
1074219625 10:111423764-111423786 AAAGCCATGAAAGGGGAGAGAGG - Intergenic
1074574074 10:114651980-114652002 AAAGCCATCAGTCAGGAGAGCGG + Intronic
1074948748 10:118306900-118306922 AAAGCAAGCAGTGTGGAGGGAGG + Exonic
1075122847 10:119676808-119676830 ACATCCAGGAGTGCTGAAAGTGG + Exonic
1075833067 10:125427810-125427832 AAAGCCAGTAGTGCTGAGGCTGG + Intergenic
1077139890 11:1019649-1019671 ACAGCCAGGAGTACGGTGGGAGG - Intronic
1077545926 11:3169766-3169788 AAAGCCAGCTGTGGGGAGCGGGG + Intergenic
1078100710 11:8328833-8328855 CAGGCCAGGAGTGAGCAGAGAGG - Intergenic
1080233455 11:30043645-30043667 AAAGCTGGGAGTGTGGAGAATGG - Intergenic
1080539379 11:33252271-33252293 AAAGCCAGGACTGCCGGGCGTGG + Intergenic
1083113323 11:60433687-60433709 AAAGCAATGAGTGCGGAGAATGG - Intronic
1083718485 11:64592376-64592398 AAAGCCAGGCAAGCAGAGAGGGG + Intronic
1084114352 11:67033160-67033182 AAAGCCCAGAGTGGGCAGAGTGG - Intronic
1086371983 11:86164136-86164158 AAAGACAGGAGGCCAGAGAGTGG + Intergenic
1088557860 11:111080931-111080953 ACAGCCAGGAGTGGGGTAAGAGG - Intergenic
1088565661 11:111170086-111170108 AAAGCCAATAATGCAGAGAGGGG - Intergenic
1088801888 11:113314459-113314481 AAAGCCAGGAGGCGGGACAGGGG - Intergenic
1088805426 11:113347960-113347982 ATAGCCAGGAGGTAGGAGAGGGG - Intronic
1088892992 11:114059424-114059446 GAAGCCCGGAGCGCGGAGCGCGG + Intergenic
1089108014 11:116031426-116031448 AAAGGCAGATGTGCAGAGAGAGG - Intergenic
1089146582 11:116333555-116333577 GAAGTCAGGAGTGCTGGGAGCGG - Intergenic
1089534380 11:119151515-119151537 AAAGCAAGGAGGATGGAGAGAGG + Intronic
1090351846 11:126112971-126112993 AGAGGCAGGAGTGAGGTGAGAGG - Intergenic
1090687731 11:129142205-129142227 GAAGACAGGAGGGCGGAAAGAGG - Intronic
1090880422 11:130827789-130827811 ACACCCACGTGTGCGGAGAGGGG - Intergenic
1090974204 11:131667888-131667910 AAACCCAGCAGTGGGAAGAGAGG - Intronic
1091364502 11:135006532-135006554 AAATCCAGGAGTTCAGAGACGGG + Intergenic
1091586979 12:1822120-1822142 AAAGCCAGGCCCGCGGGGAGGGG + Intronic
1094302593 12:28982333-28982355 AAAGTAGGGAGTGTGGAGAGAGG - Intergenic
1094587592 12:31792287-31792309 AAAGAGAGGAGGGCGCAGAGCGG - Intergenic
1095468985 12:42516819-42516841 AAGGCAAGGGGTGGGGAGAGGGG - Intronic
1096059214 12:48682267-48682289 GTAGCCAGGAGTCCGGAAAGGGG - Intergenic
1096208221 12:49741441-49741463 AAAGGCAGGAGTGCGGCCAACGG + Intronic
1098700920 12:73624663-73624685 AAAGCCAGATGTGGGGAAAGGGG + Intergenic
1100738773 12:97567695-97567717 AAAGTCAGCAATGGGGAGAGTGG - Intergenic
1100959101 12:99943384-99943406 AAAGCCAGAAGAGTGGAGAAAGG - Intronic
1100977966 12:100142335-100142357 GGAGCCCGGAGTGCGGAGCGCGG - Intronic
1101099273 12:101375506-101375528 AATGTCAGGAGTGCCGAGGGAGG + Intronic
1102108720 12:110348048-110348070 AAAAGCCGGAGTGGGGAGAGAGG + Intronic
1102980784 12:117239297-117239319 AAAGGCAGGAGAGAGGAGGGAGG - Intronic
1103246032 12:119458318-119458340 AAAGCCAGGAGTGCTTTGACGGG - Intronic
1103727835 12:123007552-123007574 AAAGCCAGGGGTGGGAAGTGAGG - Intronic
1104959702 12:132482822-132482844 AAAGCCAGGAGTGGGGCGAGTGG + Intergenic
1110092571 13:71471299-71471321 AAAGGCAGGCTTGGGGAGAGGGG + Intronic
1110979278 13:81874960-81874982 AAAGGTAGGAGGGTGGAGAGGGG + Intergenic
1111503641 13:89158422-89158444 AAAGACAGGGTTGGGGAGAGAGG - Intergenic
1111991359 13:95120621-95120643 GAAGCCAGAAGTACAGAGAGAGG + Intronic
1113761421 13:112850023-112850045 AAAGCCAGAAGTTGGGAAAGGGG - Intronic
1114336033 14:21690874-21690896 AAAGTCAGGAGGGAGGAAAGGGG + Intergenic
1115907006 14:38211286-38211308 AAAGCCTGGAGTTCGAAGCGCGG - Exonic
1117678223 14:58177003-58177025 AAAGAAAGGGGTGGGGAGAGAGG + Intronic
1119586951 14:75844945-75844967 AATGGCAGGAGTGTGGAGGGTGG - Intronic
1121113984 14:91330978-91331000 GAGTCCAGGAGTGGGGAGAGTGG + Intronic
1121142289 14:91554338-91554360 AAAACCAGCAGTTCGCAGAGCGG - Intergenic
1121155011 14:91674981-91675003 AAAGCCAGCAGTTGGGAGAGTGG - Intronic
1121534743 14:94683849-94683871 AACACCAGGAGGGAGGAGAGGGG - Intergenic
1121744874 14:96280108-96280130 ACAGCCAGAAGAGGGGAGAGGGG + Intergenic
1125852986 15:42921649-42921671 AAAGCGAGGAGGGCGGAGCAAGG + Intergenic
1127277579 15:57460902-57460924 AAGGCCTGGAGTGCAGAGAGGGG + Intronic
1127827672 15:62719218-62719240 AAAGCCAGGGGAAAGGAGAGAGG - Intronic
1127906760 15:63381838-63381860 GAAGCCAGGAGAGCGAAGGGCGG - Exonic
1127998960 15:64172861-64172883 AAAGACAGGAGTGAGGATGGGGG - Intronic
1129032385 15:72628701-72628723 AAAGCCAGGTGGGAGGAGTGGGG + Intergenic
1129217509 15:74108538-74108560 AAAGCCAGGTGGGAGGAGTGGGG - Intronic
1129407147 15:75327438-75327460 AAAGCCAGGTGTGAGGAGTGGGG + Intergenic
1129470342 15:75750275-75750297 AAAGCCAGGTGTCAGGAGTGGGG + Intergenic
1129683664 15:77672271-77672293 AAGGCCAGGAGGGAGGGGAGGGG - Intronic
1129696416 15:77742949-77742971 AAAGCTTGGGGTGCGGTGAGAGG + Intronic
1129734668 15:77952839-77952861 AAAGCCAGGTGTGAGGAGTGGGG - Intergenic
1129741803 15:77992885-77992907 ATAGCCTGGAGTGGGGGGAGTGG - Intronic
1129840922 15:78743152-78743174 AAAGCCAGGTGTGAGGAGTGGGG + Intergenic
1129944077 15:79524212-79524234 AGAGCCAGGAGTGGGAAGGGAGG - Intergenic
1130227280 15:82068912-82068934 AAAGCCCGGGGTGGGGATAGAGG - Intergenic
1131072269 15:89473321-89473343 AAGGCCAGAAGTGGGTAGAGAGG + Intronic
1132029875 15:98430696-98430718 AAAGCCAGGAGTCCCCAGTGGGG + Intergenic
1133017152 16:2949312-2949334 AAAGTGTGGAGTGCGGAGCGAGG - Exonic
1134449667 16:14355417-14355439 AAAGCCAAGAGTGGGGGGGGGGG + Intergenic
1134817538 16:17218323-17218345 AAACTCAGGGGTGGGGAGAGGGG + Intronic
1135194830 16:20386021-20386043 AAAACCAGGTGTGGGGAGGGCGG + Intronic
1135925842 16:26693441-26693463 TAACCCAGGACTGCAGAGAGAGG - Intergenic
1136398585 16:30005889-30005911 AGAGGCAGGAGTGAGGAGCGCGG + Exonic
1137402574 16:48165276-48165298 AAAGCCAGGACTGAGGGGAAGGG + Intergenic
1139561387 16:67744561-67744583 GAAGCCAAGAGTGCTGACAGAGG - Intronic
1139691534 16:68645134-68645156 AAAGCCAGGAGAGCGCAGGAGGG + Exonic
1139747822 16:69088625-69088647 AAAGTCAGGAGGGAGGAGCGTGG + Intergenic
1140628981 16:76829281-76829303 AAAGCCAGGAGAGAGAAGACAGG - Intergenic
1141405826 16:83792004-83792026 AGAGCCTGGATTGCGGAAAGGGG - Intronic
1141678216 16:85528903-85528925 AAAGCCAGGAGATCAGCGAGTGG + Intergenic
1142291884 16:89197033-89197055 GAAGCCAGGAGTGCGGGGTGGGG - Intronic
1142312939 16:89324357-89324379 AAAGCCAGGAGGGCGGCACGTGG + Intronic
1142491646 17:283613-283635 AAGGCCAGCAGTGAGGAGTGTGG - Intronic
1142492669 17:288947-288969 TGAGACAGGAGTGGGGAGAGAGG - Intronic
1143914780 17:10282150-10282172 AAAGCCAGAAGCTAGGAGAGAGG - Intergenic
1145831190 17:27917539-27917561 AAAGCCTGGAGTGAGGAGCAGGG - Intergenic
1145868998 17:28258380-28258402 CAAGCCAGGAGTGGTTAGAGAGG + Intergenic
1145908633 17:28529843-28529865 TCAGCCAGGAGTGCAGAGAAGGG + Intronic
1145993387 17:29092335-29092357 AAAGCCAAGACAGCGGTGAGGGG - Exonic
1146955027 17:36932479-36932501 AGAGGCAGAAGTGAGGAGAGAGG - Intergenic
1146975509 17:37107922-37107944 AAGGCCAGGAGCAGGGAGAGTGG - Intronic
1148678295 17:49457809-49457831 CAAGGCCGGAGTGCAGAGAGAGG + Intronic
1148712473 17:49691840-49691862 AAAGGGAGGAGTGTGAAGAGAGG + Intergenic
1149519741 17:57309790-57309812 ACAGCCAGAAGAGAGGAGAGAGG + Intronic
1149637892 17:58185000-58185022 CAAGGCAGGAGGGAGGAGAGAGG + Intergenic
1151396087 17:73823947-73823969 AATGCCAGGAGGGAGGAGAAAGG + Intergenic
1151685198 17:75642181-75642203 GAACCCAGGAGTGAGGGGAGGGG + Intronic
1151983437 17:77527702-77527724 AATGCCAAGAGTGCCAAGAGTGG + Intergenic
1152014263 17:77739451-77739473 AAAGTCCGGAGAGGGGAGAGGGG + Intergenic
1153047921 18:873296-873318 AAAGCCGGGAGTGAGGAGGGGGG + Intergenic
1153619140 18:6960491-6960513 GTTGCCAGGAGTGGGGAGAGAGG + Intronic
1155812686 18:30258281-30258303 ATTGCCAGGAGTTAGGAGAGAGG - Intergenic
1156564236 18:38165535-38165557 AAAACCAGGAGTGCCAAGTGTGG + Intergenic
1158886240 18:61829716-61829738 AAAGCAAGGGGTGCTGAGAAAGG + Intronic
1158900923 18:61961192-61961214 GATGCCAGGAGTGTGGAGAAGGG - Intergenic
1159846992 18:73473074-73473096 CAAGCTAGAAGTGAGGAGAGAGG + Intergenic
1160788795 19:913310-913332 AAACCCAGGCGCGCGGGGAGGGG + Intergenic
1161056297 19:2192141-2192163 AAAGCCAGGACTGTGGAAAGGGG - Intronic
1161458390 19:4381482-4381504 AGAGGCAGGAGAACGGAGAGAGG - Intronic
1161467191 19:4437588-4437610 AATGCCAGGAGGCTGGAGAGAGG - Intronic
1161718914 19:5892600-5892622 AAGGCCTGGAGTGCGGAGGAAGG + Exonic
1162139511 19:8577416-8577438 AAAGCCGGGAGTCCGGTGAACGG - Exonic
1164628440 19:29745227-29745249 AAAGCGAGGTGGGCTGAGAGTGG + Intergenic
1165900461 19:39167134-39167156 TAAGCCCGGAGGGCGGACAGCGG - Intronic
1166543770 19:43622502-43622524 AAAGCCAGGAATGGGGAGAGGGG + Exonic
1167045416 19:47046307-47046329 AAAGCCAGGGTTGAGGAGACAGG + Intronic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1167645413 19:50702850-50702872 GAAGCCAGGAGGCAGGAGAGGGG - Intronic
1168148320 19:54431502-54431524 AGAGGCAGGAGGACGGAGAGAGG - Intronic
1168250917 19:55141474-55141496 AAAGACGGGAGTGGGGAGTGGGG + Intronic
1168380249 19:55914129-55914151 AAACCCAGGAATGGGGAGAATGG - Intronic
925011931 2:492474-492496 AAAGCCTAGAGTGCAGACAGAGG - Intergenic
928064052 2:28145339-28145361 AAAGCCAGGAGTCAGGCAAGGGG - Intronic
929605371 2:43230549-43230571 AAAGCCAGAAAAGGGGAGAGGGG + Intergenic
931264860 2:60651737-60651759 AAAGAGGGGACTGCGGAGAGAGG + Intergenic
931665623 2:64608179-64608201 GAAGACAGGAGGGAGGAGAGCGG - Intergenic
932330935 2:70897904-70897926 AAAGCCAGGATTCCTGAGGGAGG + Intergenic
933387001 2:81623559-81623581 AATGCCATGAGGGCTGAGAGAGG - Intergenic
933780237 2:85796008-85796030 AAAGCGGGGAGAGCCGAGAGAGG - Intergenic
935595395 2:104873707-104873729 AGACCCAGGAGTGCAGAGAGTGG - Intergenic
935703929 2:105839774-105839796 AAAGCCAAGAGGGCGGATGGAGG + Intronic
936733987 2:115418069-115418091 AAAGTCAGTAGTGTGAAGAGAGG + Intronic
937140065 2:119592448-119592470 AAAGCCGGGAGTTCTAAGAGGGG - Intronic
937940003 2:127277821-127277843 GAAAACAGGAGTGGGGAGAGTGG + Intronic
937988846 2:127651168-127651190 CAGGCCAGGTGTGCGTAGAGGGG - Exonic
938042926 2:128091043-128091065 AAAGGCGGAAGTGAGGAGAGAGG + Intergenic
938115848 2:128602597-128602619 AGAGCCAGGTGTGTGGACAGTGG - Intergenic
938141295 2:128796730-128796752 AAAGCCTGGAGTGTGGACACAGG - Intergenic
938338301 2:130518432-130518454 GAAGCCAGGAGGGTGGAGAAAGG + Intergenic
938351538 2:130602318-130602340 GAAGCCAGGAGGGTGGAGAAAGG - Intergenic
939082046 2:137674136-137674158 AAAGCCAGGAGAACGGCTAGAGG - Intronic
940033799 2:149292079-149292101 AAAGCCAGGAGAGAGGGGTGGGG + Intergenic
940559874 2:155281607-155281629 ACTGCCAGGAGTTGGGAGAGGGG + Intergenic
944096233 2:195971678-195971700 AAAGTCATGAGTGAGGAGTGGGG + Intronic
945720044 2:213407860-213407882 AGAGACAGGAGAGAGGAGAGAGG + Intronic
946171840 2:217900338-217900360 AAAGCCACGGGTGGGGAGTGTGG - Intronic
946383201 2:219363677-219363699 AAAGCCTGGAGTCAGGAGTGGGG + Intergenic
947970170 2:234316861-234316883 AAAGCCAGGCCTGCGCACAGTGG + Intergenic
948073000 2:235142523-235142545 GAATCCAGGAGTGCGGAGGGTGG - Intergenic
948313131 2:237004661-237004683 GAAGCCAGGAGAGAGGAGACTGG + Intergenic
948514391 2:238494590-238494612 AAACGCAGGCGTGCGGAGAGAGG - Intergenic
948626483 2:239272204-239272226 AAAGCCAGGAGCCCCAAGAGGGG + Intronic
948839828 2:240643419-240643441 AAAGGCAGGTGGGCGGAGTGGGG - Intergenic
1168961163 20:1871042-1871064 AGAGGCAGGGGTGCGGAAAGGGG + Intergenic
1169444131 20:5657269-5657291 AAAGCCTGGAGTGGGGTGGGTGG + Intergenic
1169889348 20:10435512-10435534 AAAACCAGGAGGGAGGAGATGGG - Intronic
1171443706 20:25187776-25187798 ATAGACAGGATTGCGGAGAAGGG - Intergenic
1172452344 20:35035283-35035305 AAAGCCAGGAATGCTGAGAAGGG + Exonic
1172793930 20:37524310-37524332 AAACCCAGTATTGGGGAGAGAGG - Intronic
1173646875 20:44638880-44638902 CAAGGCAGGGGTGCGGAGGGAGG + Intronic
1173818908 20:46008409-46008431 AGAGCCTGGAGTGTGGGGAGGGG + Intergenic
1173959085 20:47057449-47057471 AAAGCCACAAGTGGGTAGAGAGG - Intronic
1174332727 20:49832593-49832615 AAAGCCGTGAGTGGGGAGAGGGG - Intronic
1175170246 20:57075160-57075182 AAGCCCAGGAGCGTGGAGAGAGG + Intergenic
1175944104 20:62550812-62550834 AAGGGCAGGGGTGTGGAGAGGGG + Exonic
1176728374 21:10464062-10464084 AAAGCAAGAAGAGCTGAGAGAGG - Intergenic
1178282334 21:31294154-31294176 AAGGCCAGCAGTGGGGAGGGAGG + Intronic
1178910190 21:36667849-36667871 AAAGCCAGGAGTGAGGAAATGGG - Intergenic
1179161287 21:38901349-38901371 AAAGAAAGGAGTGCAGAGAGAGG - Intergenic
1179245501 21:39630712-39630734 AAAGCTGGGATTGCTGAGAGTGG + Intronic
1179505324 21:41836001-41836023 AATCCCAGGAGGGAGGAGAGTGG - Intronic
1180898222 22:19352854-19352876 AAAGCCAGGTGTGCTGGAAGAGG - Intronic
1181558668 22:23686886-23686908 GTGGCGAGGAGTGCGGAGAGTGG - Intergenic
1181639450 22:24189003-24189025 TAAGCCTGGAGTGCCGAGGGAGG - Exonic
1183290375 22:36998419-36998441 AGGGCCTGGAGTGAGGAGAGAGG + Intronic
1183668024 22:39256332-39256354 CAAGGCAGGAGTGTGGGGAGAGG - Intergenic
1184015605 22:41783614-41783636 AAAGTCAGGCATGCTGAGAGAGG + Intronic
1184739793 22:46421225-46421247 AAGGCCAGGAGCCCAGAGAGGGG + Intronic
1185242483 22:49754152-49754174 AAAGCAGGGAGTGTGGGGAGAGG + Intergenic
949494511 3:4619474-4619496 AGAGGGAGGAGTGAGGAGAGAGG - Intronic
949873196 3:8606693-8606715 AAAGCCAGCACTGCAGAGAAGGG - Intergenic
950190047 3:10970374-10970396 GAAGGCAGGAGTAAGGAGAGAGG + Intergenic
950288723 3:11766206-11766228 ACAGGCTGGAGTGCGGAGTGAGG + Intergenic
950430036 3:12945269-12945291 GAACCCAGGAGTGCCCAGAGCGG - Intronic
950726141 3:14918299-14918321 ATGGCCAGGAGAGCTGAGAGAGG + Intronic
952923513 3:38305491-38305513 AAAGGCAGGAGTGGGGAAGGAGG - Intronic
953550145 3:43895774-43895796 AAAGCCAGCAGTGAGGAAATGGG - Intergenic
953907044 3:46873630-46873652 AGAGCCAGCTGTGCTGAGAGAGG + Intronic
955555392 3:60131798-60131820 AAAGCAAGCAGTGTGGAGAATGG - Intronic
956708349 3:72018742-72018764 AAAAACAGCAGTGCAGAGAGAGG + Intergenic
957948073 3:87089496-87089518 AAAGCCATGCCTGCGGGGAGAGG + Intergenic
959410471 3:106015053-106015075 AGAGCCAGGAGTGGGGAAATGGG + Intergenic
960399739 3:117181618-117181640 AAAGCCACAAGTGAGGAGATTGG + Intergenic
961002489 3:123383404-123383426 AAAGCCATGAGTGGAGAGAGTGG - Intronic
961503645 3:127355743-127355765 AAAGCCAGGGATGGGGAGGGTGG - Intergenic
961754268 3:129118476-129118498 AAAGCCAAGAGGTCAGAGAGAGG - Intronic
962217970 3:133539081-133539103 AAAGGCTGGGGTGCGGGGAGGGG - Intergenic
966562291 3:181336286-181336308 AAAGCGGGGAGGGTGGAGAGAGG + Intergenic
967839425 3:193992879-193992901 AAAGAGAGGAGAGAGGAGAGAGG + Intergenic
968283744 3:197496143-197496165 AAAGCAAGGAGGGCGGCCAGTGG - Intergenic
969243667 4:5918714-5918736 AAATGCAGAAGGGCGGAGAGAGG - Intronic
969571435 4:8011008-8011030 AAAGCCAGGAGGTTGGAAAGTGG + Intronic
969842566 4:9893229-9893251 AGAGCCAGGAATGCGGAGGGGGG - Intronic
970384818 4:15545668-15545690 AAAGCCAGGAGTGAGGGGATGGG + Intronic
971503434 4:27341173-27341195 GAACCCAGGAGTGGGGAAAGTGG + Intergenic
972150202 4:36079822-36079844 AAAGGCAGGGGTGGAGAGAGTGG + Intronic
972216509 4:36903889-36903911 AAAGACAGGTGTGGGGAGATGGG - Intergenic
973789726 4:54366795-54366817 AAGGCCAGGAGTGGGGAGGAAGG + Intergenic
974631009 4:64489016-64489038 AAAACCAGGACTGTGGAGAAGGG + Intergenic
977034636 4:91934344-91934366 AAAGCAAGGAGAGAGTAGAGTGG - Intergenic
980095986 4:128491361-128491383 AAAGCCAGGAGTGCAGGACGAGG + Intergenic
982094608 4:151910651-151910673 AATGCGAGGAGTGGGGAGGGAGG + Intergenic
982660433 4:158200259-158200281 AAAGCAAGGAGGGAGGAGGGAGG - Intergenic
982982741 4:162161969-162161991 AAAGCCTGGATTGGGTAGAGGGG - Intronic
983708878 4:170690235-170690257 AAAGTGAGGAATGAGGAGAGAGG + Intergenic
984508742 4:180653755-180653777 AAAGCCAGGAGTTTGCAGAAAGG + Intergenic
984999385 4:185469658-185469680 GGAGGCAGGAGGGCGGAGAGGGG + Intronic
985943029 5:3153729-3153751 AAAGCGAGGAGTGAGGGGAGGGG + Intergenic
986102182 5:4623143-4623165 AAACCCTGGAGTGGGGAGGGGGG + Intergenic
986132376 5:4943123-4943145 AAAGCCAGGAGAGGCCAGAGAGG + Intergenic
986716757 5:10530332-10530354 AAGCCCAGGAGTGAGGAGAGAGG + Intergenic
987434200 5:17874186-17874208 AAAGGCAGTAGTACTGAGAGAGG + Intergenic
990430403 5:55729168-55729190 AAAGCCAGGAGCGGGGAAGGAGG - Intronic
993701565 5:91125100-91125122 AAAGCCAGCAGAGTGGACAGAGG + Intronic
995112974 5:108447821-108447843 TAAGCCAGGAGTGCTGGGATGGG - Intergenic
995853597 5:116572486-116572508 AGAGCCAGGTGTGCGTGGAGCGG - Intronic
997973514 5:138424236-138424258 AAAGCCAGGAGTGAGAAGTATGG - Exonic
1001214813 5:169845772-169845794 AATGCTAAGAGTGCTGAGAGGGG + Intronic
1001245854 5:170105657-170105679 AAAGCCGGGAGAGAGGATAGAGG + Intergenic
1001350491 5:170958400-170958422 GAAGCCAGGGGTGAGGTGAGAGG + Intronic
1001965734 5:175908677-175908699 AAGGCCAGGAGGGCAGAAAGGGG - Intergenic
1002251211 5:177930519-177930541 AAGGCCAGGAGGGCAGAAAGGGG + Intergenic
1002371376 5:178757698-178757720 AGAGCCAGGAGTGCTGAGGGCGG - Intergenic
1002860923 6:1078708-1078730 AAAGCCAGGACAGCAGATAGAGG + Intergenic
1002899711 6:1400474-1400496 CAAGCCTGGAGTGTGGGGAGAGG + Intergenic
1003178279 6:3770298-3770320 AAAGCCAGCCAGGCGGAGAGGGG + Intergenic
1003180412 6:3786190-3786212 AAGGCCAGGACTGCAGAGAAAGG + Intergenic
1003885828 6:10520659-10520681 AAAGCCAGAGGTTCAGAGAGAGG + Intronic
1004031455 6:11874130-11874152 AAAACCAGGAGTGCTGAGGGAGG + Intergenic
1004296436 6:14416081-14416103 CAGTCCAGGAGTGGGGAGAGAGG - Intergenic
1006444173 6:34069605-34069627 AAAGCCGGGAGTGTGTTGAGGGG - Intronic
1007246307 6:40465758-40465780 AATACCAGGAGTGAGGAGGGTGG + Intronic
1007375254 6:41451977-41451999 GAAGGCAGGAGAGAGGAGAGCGG - Intergenic
1007425756 6:41744849-41744871 AAAGAGAGGAGTGGGAAGAGAGG - Intronic
1007735562 6:43980245-43980267 AAAGAAATGTGTGCGGAGAGAGG - Intergenic
1008478648 6:51960809-51960831 AAAGCCAAAAGTTCTGAGAGAGG - Intronic
1008604852 6:53130430-53130452 AAATTCAGGAGGGCGGGGAGGGG + Intronic
1009364085 6:62844728-62844750 ATAGCCAGGGGTGCAGAGGGGGG + Intergenic
1012932316 6:105329995-105330017 ACAGCCAGGAATGAGGAGAGGGG + Intronic
1015275673 6:131381268-131381290 AAATTCAGCAGTGCGGAGAGGGG + Intergenic
1016401332 6:143684146-143684168 TGAGCCTGGAGTGCAGAGAGAGG - Intronic
1017075583 6:150614657-150614679 AGAGCCAGGAGTGTGGACGGAGG - Intronic
1021504082 7:21361625-21361647 AAAGCCAAGATAGTGGAGAGAGG - Intergenic
1022029748 7:26481396-26481418 ACAGCCTGGAGGGAGGAGAGTGG - Intergenic
1022129862 7:27395259-27395281 AAGGACAGGAGGGTGGAGAGAGG - Intergenic
1023757238 7:43431342-43431364 ATAGCTAGGAATGCAGAGAGGGG - Intronic
1024575494 7:50760178-50760200 AAGGCCAGCAGAGCGGTGAGAGG + Intronic
1026431094 7:70347886-70347908 TAAGCCAGCAGAGCAGAGAGTGG - Intronic
1028531330 7:91841974-91841996 GAAGCCAGAAGTGTGGAGAGAGG - Intronic
1028582587 7:92423008-92423030 AGAGCCAGGGGTGCGGGGAAAGG + Intergenic
1030878863 7:114851163-114851185 AAAACCAGGCCTGAGGAGAGAGG - Intergenic
1031330088 7:120453346-120453368 AAACACTGGAGTGAGGAGAGGGG - Intronic
1034440155 7:151082122-151082144 AAAGACAGGGGTTGGGAGAGTGG - Intronic
1034601720 7:152263910-152263932 AAAGCAAGAAGAGCTGAGAGAGG + Intronic
1035306241 7:157934417-157934439 AAAGCCATGGGAGCAGAGAGAGG + Intronic
1035628797 8:1092832-1092854 AAGGCCAGGAGTGTGGACCGGGG + Intergenic
1036507920 8:9372540-9372562 AAAGCCAGGAAGGCAGACAGAGG - Intergenic
1036643052 8:10595978-10596000 AGAGCCTAGAGTGCTGAGAGAGG + Intergenic
1036826344 8:11978905-11978927 AGGGCCAGGAGTGCAGAGAGGGG - Intergenic
1037325649 8:17687296-17687318 TGAGCCAGGAGTGCTGAGAGTGG - Intronic
1037513900 8:19610690-19610712 AAAGTCAGAAGTGGGTAGAGTGG - Intronic
1038895119 8:31774120-31774142 AAAGCCAGCAAAGGGGAGAGTGG - Intronic
1039606346 8:38884017-38884039 AAAACCAGGAGTGGGGTAAGGGG + Intergenic
1042226146 8:66515863-66515885 AAAGCCAGGAGTGGGTGGGGAGG - Intronic
1045684512 8:104698577-104698599 AAATCAAGAAGTGAGGAGAGGGG + Intronic
1046327948 8:112674431-112674453 AAGGCCAAGAGTGAGGAGAATGG + Intronic
1047968239 8:130063418-130063440 AAAGCCAGGAGTGCGGAGAGAGG - Intronic
1048107041 8:131422198-131422220 CAAGCTTGGAGTGAGGAGAGAGG + Intergenic
1048435293 8:134410852-134410874 AAAGCCAGGAGTACTGACATGGG - Intergenic
1049169251 8:141148390-141148412 AAAGGCAGGTGAGCGCAGAGTGG - Intronic
1050902174 9:10962998-10963020 ATAGCCAGGAGGGGAGAGAGGGG - Intergenic
1052362273 9:27573663-27573685 AGAGCAAGTAGTGGGGAGAGAGG + Intronic
1053199500 9:36142909-36142931 CCAGCCAGGAGTGGGGAGAGAGG + Intronic
1053329374 9:37188968-37188990 AAAGGAAGGAGTGGGGAGAGGGG - Intronic
1056918225 9:90762974-90762996 AAAACCAGGAGGGGGGAGAGGGG + Intergenic
1058291136 9:103241454-103241476 AGAGCTAGGAGTGGTGAGAGAGG - Intergenic
1059170177 9:112117269-112117291 AAAGCCATGTGAGAGGAGAGAGG - Intronic
1060206867 9:121687280-121687302 AAAGCCAGGGGTTCTGAAAGGGG + Intronic
1061661278 9:132132000-132132022 AGAGCCAGGAGGCTGGAGAGAGG - Intergenic
1062674308 9:137731458-137731480 AAAGACAGGAGTGCAGATGGAGG + Intronic
1190984017 X:55484409-55484431 ATAGCCAGGTGTGTGGAGGGAGG - Intergenic
1193451805 X:81679919-81679941 AAAGGCAGGAGTGGGTACAGAGG - Intergenic
1193582107 X:83278567-83278589 AAAGCCAGTAGAGCAGAGATAGG + Intergenic
1193643228 X:84037206-84037228 AAAGGCAGTAGTGTGGAAAGGGG - Intergenic
1196011532 X:110893024-110893046 TAAACCAGGAGTGAGGAGTGAGG - Intergenic
1196061076 X:111409008-111409030 AATGAAAGGAGTGAGGAGAGAGG + Intronic
1197709200 X:129654033-129654055 ATAGGCAGGAGTGCGCGGAGGGG - Intronic
1200180982 X:154150551-154150573 AAAGGCAGGAGGGCGGAAGGGGG + Intronic
1200186625 X:154187665-154187687 AAAGGCAGGAGGGCGGAAGGGGG + Intergenic
1200192277 X:154224803-154224825 AAAGGCAGGAGGGCGGAAGGGGG + Intronic
1200198032 X:154262607-154262629 AAAGGCAGGAGGGCGGAAGGGGG + Intronic