ID: 1047971575

View in Genome Browser
Species Human (GRCh38)
Location 8:130089053-130089075
Sequence GTTCATGTACTAGGAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047971570_1047971575 28 Left 1047971570 8:130089002-130089024 CCTTAGAGCACTTTGCTCTGCTG 0: 1
1: 0
2: 2
3: 10
4: 203
Right 1047971575 8:130089053-130089075 GTTCATGTACTAGGAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047971575 Original CRISPR GTTCATGTACTAGGAAAGAC AGG Intronic
No off target data available for this crispr