ID: 1047971867

View in Genome Browser
Species Human (GRCh38)
Location 8:130091502-130091524
Sequence CCGATCATGCAGGGCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047971855_1047971867 24 Left 1047971855 8:130091455-130091477 CCAGCCCTGAAGATAGAGTGGCA 0: 1
1: 0
2: 2
3: 7
4: 173
Right 1047971867 8:130091502-130091524 CCGATCATGCAGGGCCCTGTGGG No data
1047971857_1047971867 20 Left 1047971857 8:130091459-130091481 CCCTGAAGATAGAGTGGCAGGAG 0: 1
1: 0
2: 3
3: 20
4: 222
Right 1047971867 8:130091502-130091524 CCGATCATGCAGGGCCCTGTGGG No data
1047971858_1047971867 19 Left 1047971858 8:130091460-130091482 CCTGAAGATAGAGTGGCAGGAGA 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1047971867 8:130091502-130091524 CCGATCATGCAGGGCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047971867 Original CRISPR CCGATCATGCAGGGCCCTGT GGG Intronic
No off target data available for this crispr