ID: 1047972553

View in Genome Browser
Species Human (GRCh38)
Location 8:130097669-130097691
Sequence CAGGCCCACGGGCAGTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047972545_1047972553 17 Left 1047972545 8:130097629-130097651 CCCAGGCAGTGTATTGCAGAAGT 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1047972553 8:130097669-130097691 CAGGCCCACGGGCAGTTTTCAGG No data
1047972546_1047972553 16 Left 1047972546 8:130097630-130097652 CCAGGCAGTGTATTGCAGAAGTG 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1047972553 8:130097669-130097691 CAGGCCCACGGGCAGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047972553 Original CRISPR CAGGCCCACGGGCAGTTTTC AGG Intronic
No off target data available for this crispr