ID: 1047978046

View in Genome Browser
Species Human (GRCh38)
Location 8:130151070-130151092
Sequence AACAAAAGATTGCTGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047978042_1047978046 8 Left 1047978042 8:130151039-130151061 CCTACACCAGAACATGGCAGAAT 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1047978046 8:130151070-130151092 AACAAAAGATTGCTGAAGAAGGG No data
1047978044_1047978046 2 Left 1047978044 8:130151045-130151067 CCAGAACATGGCAGAATGGAAGC 0: 1
1: 1
2: 1
3: 20
4: 169
Right 1047978046 8:130151070-130151092 AACAAAAGATTGCTGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047978046 Original CRISPR AACAAAAGATTGCTGAAGAA GGG Intronic
No off target data available for this crispr