ID: 1047979837

View in Genome Browser
Species Human (GRCh38)
Location 8:130169589-130169611
Sequence AGCAATAATACCAACGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047979831_1047979837 26 Left 1047979831 8:130169540-130169562 CCTCAAAGATCCCTGTGTTCCAA 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1047979837 8:130169589-130169611 AGCAATAATACCAACGGGTTTGG No data
1047979833_1047979837 15 Left 1047979833 8:130169551-130169573 CCTGTGTTCCAACATATATTTGA 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1047979837 8:130169589-130169611 AGCAATAATACCAACGGGTTTGG No data
1047979832_1047979837 16 Left 1047979832 8:130169550-130169572 CCCTGTGTTCCAACATATATTTG 0: 1
1: 0
2: 0
3: 22
4: 260
Right 1047979837 8:130169589-130169611 AGCAATAATACCAACGGGTTTGG No data
1047979834_1047979837 7 Left 1047979834 8:130169559-130169581 CCAACATATATTTGAAACACAAG 0: 1
1: 0
2: 1
3: 30
4: 394
Right 1047979837 8:130169589-130169611 AGCAATAATACCAACGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047979837 Original CRISPR AGCAATAATACCAACGGGTT TGG Intronic
No off target data available for this crispr