ID: 1047980988

View in Genome Browser
Species Human (GRCh38)
Location 8:130181939-130181961
Sequence CTGTGTATAGGTAAGGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047980988 Original CRISPR CTGTGTATAGGTAAGGATGT TGG (reversed) Intronic
902689862 1:18104323-18104345 CTGTGTCTAGGTAAGGTGTTTGG + Intergenic
902855023 1:19195953-19195975 GTGTGTATAAGTAAGTCTGTAGG - Intronic
904674925 1:32193201-32193223 CTGTGTATAGGGCAAGCTGTGGG - Exonic
906925354 1:50110035-50110057 GTGTGTATGTGTAAGGATGCTGG + Intronic
906931689 1:50176381-50176403 ATGTGTATAGTTAAGGATGCAGG - Intronic
907634213 1:56117203-56117225 CTGTGTAAAGCTGAGGATGGTGG + Intergenic
909855919 1:80531436-80531458 CTGTGTAGAGGAAAAGAAGTGGG - Intergenic
912197773 1:107419654-107419676 CTGTATATAGCTAAGGAAGGTGG - Intronic
913482087 1:119298518-119298540 CAGAGTATAGGCAAGGATGAGGG - Intergenic
915128480 1:153681359-153681381 CTGGGAATAGGGAAGGATGGAGG - Intronic
919772158 1:201169132-201169154 CTGTGTGTAGGTATAGAGGTGGG + Intronic
924693888 1:246380197-246380219 GTGTGTATAGGAGAGGATGAAGG - Intronic
1063647442 10:7899188-7899210 CTGCGCACAGGCAAGGATGTAGG - Intronic
1064121374 10:12622826-12622848 CTGAGTAGAGGGGAGGATGTAGG + Intronic
1064341036 10:14485512-14485534 CTGTGTATATGTGGGGATGGGGG - Intergenic
1065918226 10:30369504-30369526 CTTTGTAGAGGGAGGGATGTGGG - Intronic
1066618059 10:37316002-37316024 CTGTCTCTAGGTAAGAATGGGGG + Intronic
1068572031 10:58640337-58640359 CTGTTTATAGGTAAACATTTTGG - Intronic
1068607172 10:59018569-59018591 CTGTTTATAGGTAAGGGACTGGG + Intergenic
1071571399 10:86699415-86699437 CTGTGTGGGGGTAAGGATGGAGG - Intronic
1077788327 11:5410008-5410030 CTGTGTATAGAATGGGATGTTGG - Intronic
1082855191 11:57799680-57799702 CTTTGTATAGAAAAGGATATAGG + Intronic
1084955672 11:72690051-72690073 CTGGGTATGAGGAAGGATGTGGG + Intronic
1086170282 11:83828193-83828215 TTCTGTATAGGCAAGAATGTAGG + Intronic
1086597320 11:88588543-88588565 CTGTATATGGGTAAGCAGGTAGG - Intronic
1093423144 12:18998112-18998134 CTGTGTACAGGTACAGAAGTTGG - Intergenic
1094132121 12:27085526-27085548 GTGTGTAGAGGTTAGGATATGGG - Intergenic
1094181490 12:27596925-27596947 GTGTGTAGAGGTTAGGATATGGG - Intronic
1098003770 12:65972884-65972906 CAGTCTATAGGTAAGGAGATGGG - Intergenic
1103057416 12:117832799-117832821 CTGTGCCTAGGTAAGGCTGGTGG - Intronic
1104113174 12:125723283-125723305 CTGTAGCTAGGCAAGGATGTAGG - Intergenic
1104643808 12:130483632-130483654 CTGTGTGTAGGTGAGGGTGGGGG - Intronic
1104643880 12:130483858-130483880 CTGTGTGTAGGTGAGGGTGGGGG - Intronic
1104682071 12:130759009-130759031 ATGAGTATAGATATGGATGTGGG + Intergenic
1104682171 12:130759601-130759623 GTGAGTATAGATATGGATGTGGG + Intergenic
1106808097 13:33332176-33332198 CTGTGGATAGGTGGGGAGGTGGG - Intronic
1109586281 13:64409023-64409045 CTGGGTATAGGTATGAATCTAGG - Intergenic
1119517160 14:75257378-75257400 AAGTGTTTAGGGAAGGATGTCGG + Intronic
1122801492 14:104232308-104232330 GTGTGTAATGGTAAGGATGGTGG - Intergenic
1128158725 15:65409219-65409241 CCATGTGTAGGTAAGGATGGGGG - Intronic
1129587110 15:76878974-76878996 CTGTGTACTGGTGAGGATCTGGG + Intronic
1133317317 16:4892755-4892777 CTTTGTATAGGAAAGGAGGTGGG + Intronic
1134040050 16:11061437-11061459 CAGTGTTTAGGTAAGGATGAAGG + Intronic
1134388780 16:13798885-13798907 ATGTGTATAGGTATAGATGTAGG + Intergenic
1136008430 16:27346855-27346877 CTCTGTAAAGGTAGGGCTGTGGG + Intronic
1136637755 16:31536724-31536746 CTGTGTTTAGAAGAGGATGTGGG - Intergenic
1138477081 16:57277741-57277763 CTGTGGTTAAGTGAGGATGTGGG + Intronic
1139186537 16:64812405-64812427 ATGAGTTTAGGTAAGGAAGTTGG + Intergenic
1141119077 16:81336845-81336867 CTGTGCATGGGTAGGGATGGGGG - Intronic
1146688851 17:34859289-34859311 CTGTGTATTAGTCAGGATCTTGG - Intergenic
1149681134 17:58508148-58508170 TTGTGTATAGGTGAGGCAGTGGG - Exonic
1150698116 17:67423427-67423449 CTTTCTAAAGGCAAGGATGTGGG + Intronic
1151808302 17:76420471-76420493 GTGTGTTTGGGTAAAGATGTGGG - Intronic
1153982211 18:10320176-10320198 TTGTCTATGGGTGAGGATGTAGG + Intergenic
1155018081 18:21865772-21865794 CTGTGTATACCTACGGATGAGGG + Exonic
1155790720 18:29966918-29966940 CTATTTATAGGTAAGGAAATGGG - Intergenic
1155825601 18:30438874-30438896 CAGTGTATGGGCAAGGCTGTGGG - Intergenic
1157069296 18:44387133-44387155 CTGTGTACATGTATGTATGTTGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159470358 18:68846472-68846494 CTTTGGATATGTAAGCATGTGGG + Intronic
1160470425 18:79127851-79127873 TTATGTACAGGTGAGGATGTGGG - Intronic
1160503643 18:79415177-79415199 CTTTGTAGAGGCAAGGTTGTAGG + Intronic
1166041257 19:40204423-40204445 CTGGGTATAGGTGAGGATTGGGG + Intronic
1168422280 19:56212417-56212439 CTGTGTCTGGAGAAGGATGTTGG - Intergenic
1168505694 19:56932943-56932965 CTGTAAACAGGAAAGGATGTTGG - Intergenic
925521002 2:4745927-4745949 GTGTGTATAGGTATGCAGGTGGG - Intergenic
926745689 2:16155361-16155383 CAGTTTCTAGGTAAGGAAGTTGG + Intergenic
926968766 2:18445104-18445126 ATGTGAATATGTAAGGATGAGGG - Intergenic
927463933 2:23323182-23323204 CTGTGTAAAGCTAAGGAGCTCGG + Intergenic
928697483 2:33863838-33863860 CTGTGTCTAGCTAATGAGGTAGG - Intergenic
929403568 2:41613620-41613642 CGGTGATTAGGTAAGGAGGTAGG + Intergenic
930146583 2:48013254-48013276 CATTGTATAGGTGAGGATATTGG + Intergenic
931794576 2:65697045-65697067 CAGGGTATAGGTAAGCATGATGG - Intergenic
934124002 2:88868569-88868591 ATGTGTATATGTATGTATGTAGG + Intergenic
935715602 2:105936514-105936536 CTGTGTAGATGTATGCATGTTGG - Intergenic
937092328 2:119214694-119214716 CTGTGTGGAGGTAAGGCAGTGGG + Intergenic
939977837 2:148739626-148739648 TTCTGTGTAGGTAAGGAAGTGGG - Intronic
944956173 2:204812100-204812122 CTATGTATATGTAAAAATGTAGG - Intronic
946091001 2:217223702-217223724 ATGTGTACAACTAAGGATGTGGG - Intergenic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
1168736294 20:140739-140761 CTAAGTATTGGTAAAGATGTGGG + Intergenic
1175351749 20:58326873-58326895 TTGGGAAAAGGTAAGGATGTTGG - Intronic
1175570989 20:60021833-60021855 GTGTGTACAGATAAGGATATCGG - Intronic
1175757083 20:61536698-61536720 ATGTGTATATGTATGTATGTAGG - Intronic
1177775716 21:25563564-25563586 CTGCTTTTAGGTACGGATGTGGG + Intergenic
1181508155 22:23375673-23375695 CTGTGCAAAGGTTAGGAAGTTGG - Intergenic
1182023537 22:27100402-27100424 CTGCCTAAAGGTAAGGAGGTTGG + Intergenic
1182835864 22:33340878-33340900 CAGTGTATAGGAAAGAATGTGGG - Intronic
950256863 3:11513033-11513055 CTGTGTCTAGCTCAGGATTTGGG - Intronic
952025948 3:29082469-29082491 CTGTGTCCAGGGAAGGATGGAGG + Intergenic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
955711253 3:61781498-61781520 CAGTGGAGAGGTCAGGATGTAGG - Intronic
957568974 3:81921564-81921586 CTTTTTATAGGTGAGGATCTGGG + Intergenic
957591608 3:82206235-82206257 TTATGTATTGGTAAGGATGCTGG + Intergenic
960326701 3:116305113-116305135 CTGGGAATAGGGAAGGATATTGG - Intronic
960747553 3:120907461-120907483 CTTTGTATATGTGAGGATGATGG + Intergenic
962079808 3:132126195-132126217 CTTTGTATAGGTCAGGATCCTGG - Intronic
965922317 3:173932131-173932153 TTGTGTCTAGGTGAGCATGTGGG + Intronic
968262878 3:197339315-197339337 CAGTTTAAAGGTAAGGAAGTGGG - Intergenic
968476021 4:809232-809254 CTGTCTATAGGCGAGGACGTGGG - Intronic
970872182 4:20828773-20828795 ATGTGTGTAGGTATGGAGGTAGG - Intronic
973788778 4:54359517-54359539 CTGTGCATTGGTAAAGATATGGG - Intergenic
974351433 4:60752490-60752512 CTGTGGATAGCTAAGGATTCAGG - Intergenic
978105294 4:104894844-104894866 CTATATATAGATAAGGATGAAGG + Intergenic
979503085 4:121462062-121462084 CTATGTATAGGTGAGGAAATTGG - Intergenic
979601067 4:122586987-122587009 CTGTGGGTAGGTAAATATGTGGG + Intergenic
983109106 4:163726045-163726067 CTGTATATATGTAGGGATGGGGG - Intronic
984968022 4:185157999-185158021 GTTTGTATAGGTAACTATGTGGG + Intergenic
987063499 5:14265057-14265079 CTGTGTTTTGTTAAGTATGTAGG + Intronic
987621357 5:20341085-20341107 CTCTGGTTAGGGAAGGATGTGGG - Intronic
988605889 5:32678198-32678220 CTGTGTCTAGCTAATGAGGTGGG - Intergenic
989716510 5:44468949-44468971 CTGTGTATAGGCAGCTATGTTGG + Intergenic
990961239 5:61395425-61395447 CTGTGTACAGGTATGAATGGGGG - Intronic
996091378 5:119355383-119355405 CTGTGCAAAGGTAAGGGTGGAGG + Intronic
996786256 5:127239892-127239914 CTGGGTAGAAGTAAGGATGAGGG - Intergenic
996919955 5:128756416-128756438 CTGAGTATATGTGAGGAGGTAGG + Intronic
997627464 5:135340679-135340701 CAGTATAAAGGTAAGCATGTTGG - Intronic
1000780519 5:165474469-165474491 CTGTGTAAAGGAAAGGAGGCAGG + Intergenic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1005157954 6:22829258-22829280 ATTTGTATAGGTAAGTAGGTAGG - Intergenic
1008133132 6:47740572-47740594 CTGGGGGTAGGTAAGGTTGTAGG + Intergenic
1009296430 6:61956585-61956607 CTGTGTATAGGTGAAGAGGGAGG - Intronic
1011149074 6:84248952-84248974 CAATATATAGGTAAAGATGTAGG + Intergenic
1012648124 6:101715564-101715586 CTTGGTATAGTTAAAGATGTTGG - Intronic
1013995145 6:116299598-116299620 GTGTGTATATGTATGTATGTAGG + Intronic
1018644812 6:165938019-165938041 CTTTGTAGAGGAAAGGAAGTGGG - Intronic
1020681976 7:11248083-11248105 CAGTTTATAGGTAAGGAAATGGG + Intergenic
1022518998 7:30993950-30993972 CTGTGTTTAGCTAAGGGAGTGGG - Intergenic
1026223786 7:68423137-68423159 CTGTGGATAGGTAAGCAAATGGG + Intergenic
1026437165 7:70409246-70409268 CTTGGTATACGTAAGCATGTAGG + Intronic
1026864004 7:73811328-73811350 CTGTATATGGCTAAGGCTGTGGG - Intronic
1027923525 7:84429270-84429292 ATCTGTATAGGTAAGAAAGTTGG - Intronic
1030748564 7:113200266-113200288 CTGTGTCTAGTGAAGAATGTAGG + Intergenic
1034897129 7:154884424-154884446 ATGTGTATAGGTGAGCATGTGGG - Intronic
1035728116 8:1837157-1837179 TTGTGTATGGGTCAGGATGCCGG + Intronic
1037359561 8:18058938-18058960 ATGTGTGTAGATAAGGCTGTTGG - Intronic
1037477105 8:19268629-19268651 CTTTGTATAGGTATAGATATAGG + Intergenic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1039158172 8:34586651-34586673 CTCTATATAGTTAAGCATGTAGG - Intergenic
1042166482 8:65950775-65950797 ATGTGTAGAGGTAGGGATTTGGG + Intergenic
1043661519 8:82748213-82748235 ATGTGTAGAGGTAAGATTGTGGG + Intergenic
1047830448 8:128623538-128623560 CTGTGTCTAGGAAAGGTTCTAGG - Intergenic
1047980988 8:130181939-130181961 CTGTGTATAGGTAAGGATGTTGG - Intronic
1048129561 8:131679882-131679904 ACGTGTATTGGCAAGGATGTAGG - Intergenic
1049029936 8:140027279-140027301 CTGTGTATATGTTAGGTGGTTGG - Intronic
1049135440 8:140893859-140893881 CTGTCATTTGGTAAGGATGTGGG + Intronic
1049301184 8:141871691-141871713 CTGTGTGTAGGTGAGGGTGGTGG + Intergenic
1049301230 8:141871865-141871887 CTGTGTGTAGGTGAGGGTGGTGG + Intergenic
1049301313 8:141872186-141872208 CTGTGTGTAGGTGAGGGTGGTGG + Intergenic
1049301359 8:141872363-141872385 CTGTGTGTAGGTGAGGGTGGTGG + Intergenic
1049301468 8:141872813-141872835 CTGTGTGTAGGTGAGGGTGGTGG + Intergenic
1049301650 8:141873841-141873863 CGGTGTATAGGTAAGGGTGATGG + Intergenic
1049301734 8:141874192-141874214 CGGTGTATAGGTGAGGGTGATGG + Intergenic
1049305526 8:141900953-141900975 CTGTGTATGTGTAAGTGTGTGGG + Intergenic
1050430015 9:5552822-5552844 TTGTGGATAGGTAGGGAAGTGGG - Intronic
1052445973 9:28561845-28561867 CTGTGTAAAGGTATGTCTGTAGG - Intronic
1054459143 9:65453312-65453334 ATGGGTAAAGGGAAGGATGTGGG + Intergenic
1055008829 9:71540460-71540482 AAGTGTATAGCCAAGGATGTGGG - Intergenic
1055522309 9:77093816-77093838 ATGTGCATAGATAATGATGTGGG + Intergenic
1056548483 9:87632790-87632812 CAGTGTATATGTAGGGATGAAGG + Intronic
1057157309 9:92854265-92854287 CTAGGTATGGGTAGGGATGTGGG + Intronic
1058050919 9:100405783-100405805 CTAAGTATTGGTGAGGATGTGGG + Intergenic
1059915554 9:119095660-119095682 CTTTGTATAGCTAAGGAAATTGG + Intergenic
1185724391 X:2407696-2407718 CTGCTTATAAGTAAGAATGTAGG - Intronic
1186250379 X:7659745-7659767 CTGTGTGTGGGTAATGATGTGGG + Intergenic
1187791744 X:22957869-22957891 CAGTTTTTAGCTAAGGATGTAGG - Intergenic
1188920192 X:35965299-35965321 CTCTGTATAAGTAAGTATGTTGG + Intronic
1191754473 X:64579697-64579719 CTGTGTATGGATTAGGGTGTAGG + Intergenic
1192044436 X:67657279-67657301 CTGAGTAAAGGTAAGGATAGGGG - Intronic
1192090120 X:68145643-68145665 CTCTGGAGAGGGAAGGATGTGGG - Intronic
1193146882 X:78085632-78085654 CTATGTATATGTGAGGGTGTGGG + Intronic