ID: 1047982278

View in Genome Browser
Species Human (GRCh38)
Location 8:130195702-130195724
Sequence CATTATGCAAAAGGGGCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047982268_1047982278 30 Left 1047982268 8:130195649-130195671 CCTAACCAGAAATTTGGAGTAAA 0: 1
1: 0
2: 7
3: 20
4: 258
Right 1047982278 8:130195702-130195724 CATTATGCAAAAGGGGCTTAAGG No data
1047982269_1047982278 25 Left 1047982269 8:130195654-130195676 CCAGAAATTTGGAGTAAATCAAA 0: 1
1: 0
2: 3
3: 27
4: 343
Right 1047982278 8:130195702-130195724 CATTATGCAAAAGGGGCTTAAGG No data
1047982274_1047982278 -8 Left 1047982274 8:130195687-130195709 CCGAGGTCTATCTTTCATTATGC 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1047982278 8:130195702-130195724 CATTATGCAAAAGGGGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047982278 Original CRISPR CATTATGCAAAAGGGGCTTA AGG Intronic
No off target data available for this crispr