ID: 1047983128

View in Genome Browser
Species Human (GRCh38)
Location 8:130204130-130204152
Sequence TCCGCCTCCTGTTAGATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047983123_1047983128 26 Left 1047983123 8:130204081-130204103 CCAGGCCACACAGCAGGAGTGAG 0: 2
1: 5
2: 14
3: 95
4: 771
Right 1047983128 8:130204130-130204152 TCCGCCTCCTGTTAGATCAAGGG No data
1047983124_1047983128 21 Left 1047983124 8:130204086-130204108 CCACACAGCAGGAGTGAGTTGCG 0: 1
1: 1
2: 3
3: 16
4: 100
Right 1047983128 8:130204130-130204152 TCCGCCTCCTGTTAGATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047983128 Original CRISPR TCCGCCTCCTGTTAGATCAA GGG Intronic
No off target data available for this crispr