ID: 1047989065

View in Genome Browser
Species Human (GRCh38)
Location 8:130266336-130266358
Sequence GTCTAGACATTCAGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047989058_1047989065 14 Left 1047989058 8:130266299-130266321 CCACTCTCAAGCTGCAAAGTGAT 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1047989065 8:130266336-130266358 GTCTAGACATTCAGGGATGAGGG No data
1047989056_1047989065 29 Left 1047989056 8:130266284-130266306 CCACCTGAGTGGAATCCACTCTC 0: 1
1: 0
2: 0
3: 14
4: 491
Right 1047989065 8:130266336-130266358 GTCTAGACATTCAGGGATGAGGG No data
1047989057_1047989065 26 Left 1047989057 8:130266287-130266309 CCTGAGTGGAATCCACTCTCAAG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1047989065 8:130266336-130266358 GTCTAGACATTCAGGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047989065 Original CRISPR GTCTAGACATTCAGGGATGA GGG Intronic
No off target data available for this crispr