ID: 1047990037

View in Genome Browser
Species Human (GRCh38)
Location 8:130276580-130276602
Sequence CAGCCACAGCTGAGACAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047990033_1047990037 15 Left 1047990033 8:130276542-130276564 CCTGTAGGCTGATCCCAGGGTCT 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1047990037 8:130276580-130276602 CAGCCACAGCTGAGACAATCTGG No data
1047990034_1047990037 2 Left 1047990034 8:130276555-130276577 CCCAGGGTCTTCTGTGACAGTAC 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1047990037 8:130276580-130276602 CAGCCACAGCTGAGACAATCTGG No data
1047990035_1047990037 1 Left 1047990035 8:130276556-130276578 CCAGGGTCTTCTGTGACAGTACC 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1047990037 8:130276580-130276602 CAGCCACAGCTGAGACAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047990037 Original CRISPR CAGCCACAGCTGAGACAATC TGG Intronic
No off target data available for this crispr