ID: 1047991196

View in Genome Browser
Species Human (GRCh38)
Location 8:130288466-130288488
Sequence GTAAATGCACAGCTGCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047991196_1047991199 14 Left 1047991196 8:130288466-130288488 CCTACCTGCAGCTGTGCATTTAC 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1047991199 8:130288503-130288525 TCTTACACATTAACTCTAAGAGG No data
1047991196_1047991202 22 Left 1047991196 8:130288466-130288488 CCTACCTGCAGCTGTGCATTTAC 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1047991202 8:130288511-130288533 ATTAACTCTAAGAGGGAAAAGGG No data
1047991196_1047991201 21 Left 1047991196 8:130288466-130288488 CCTACCTGCAGCTGTGCATTTAC 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1047991201 8:130288510-130288532 CATTAACTCTAAGAGGGAAAAGG No data
1047991196_1047991200 15 Left 1047991196 8:130288466-130288488 CCTACCTGCAGCTGTGCATTTAC 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1047991200 8:130288504-130288526 CTTACACATTAACTCTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047991196 Original CRISPR GTAAATGCACAGCTGCAGGT AGG (reversed) Intronic
900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG + Intronic
900770946 1:4543619-4543641 ATACAGGCACAGGTGCAGGTAGG - Intergenic
901414135 1:9105369-9105391 GCCAAGGCACAGCTGCAGGGAGG - Intronic
902073483 1:13762863-13762885 ATAGAGGCACAGCTGCAGGCAGG + Intronic
910358990 1:86395970-86395992 GTAAACGCCCAGCAGCAGCTAGG + Intronic
910447058 1:87309540-87309562 CTGAATGCACAGCAGCAGGCAGG - Intergenic
912963985 1:114221162-114221184 TTACAGGCACAGATGCAGGTAGG - Intergenic
913600990 1:120421025-120421047 GAAGCTGCCCAGCTGCAGGTGGG - Intergenic
914191957 1:145419559-145419581 GAAGCTGCCCAGCTGCAGGTGGG + Intergenic
914589864 1:149097509-149097531 GAAGCTGCCCAGCTGCAGGTGGG + Intronic
914735148 1:150409299-150409321 GTAAATGCACAGCATTAGGTAGG - Intronic
916661894 1:166929948-166929970 ATAAAACCACAGCTCCAGGTAGG - Intronic
917887683 1:179402449-179402471 ATATAAGCACAGATGCAGGTGGG - Intronic
921606783 1:217165337-217165359 GTAAATGCACAGAGGCAAGTTGG + Intergenic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
923641876 1:235771469-235771491 GAATATGCTCAGTTGCAGGTTGG - Intronic
1065475154 10:26128459-26128481 GTTAATGCACAGCTGCTCGAAGG - Exonic
1069509472 10:69030921-69030943 GGAAATCCACATCTGCAGGATGG + Intergenic
1074604579 10:114948554-114948576 GTGAATGAAAAGCTGCTGGTTGG + Intronic
1076842394 10:133052233-133052255 GTAAATGCACAGCCCCAGGCTGG - Intergenic
1078572256 11:12469347-12469369 TCAAATGCCCAGCTGAAGGTCGG - Intronic
1079911581 11:26316907-26316929 GTAAATACAAAGTTGCATGTAGG - Intronic
1080753952 11:35177526-35177548 GCAAAAGCACAGCTACAGGCTGG - Intronic
1081256243 11:40899230-40899252 GTAGATGCACAGCTGAAGAAAGG - Intronic
1084345181 11:68542229-68542251 GGAAGTGCCCAGCTGTAGGTGGG + Intronic
1084398717 11:68931492-68931514 GCAGATCCACAGCTGCAGTTTGG + Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1087579278 11:100031252-100031274 GTAAATACAAAGTTGCATGTGGG + Intronic
1088269610 11:108020157-108020179 GTAAATGTACTGCTACAGTTTGG - Intronic
1088468031 11:110162903-110162925 TGAAATGGACTGCTGCAGGTGGG - Intronic
1091308221 11:134554374-134554396 GTCAATGCACAGCTGTTGGGGGG + Intergenic
1095092839 12:38122899-38122921 GTAAATACAAAGCTGCATGCTGG + Intergenic
1097300801 12:58016794-58016816 GTAAATGCACTACTGAAAGTTGG - Intergenic
1100221750 12:92511879-92511901 ATAAGTGCACAGCTTCAGGAAGG + Intergenic
1101251348 12:102939157-102939179 GGAAATGTTCAGCTGGAGGTGGG - Intronic
1104933771 12:132353854-132353876 GTGAATGCACACCTGCAAGAAGG + Intergenic
1105405711 13:20131030-20131052 GTAAATGCTAAAATGCAGGTGGG + Intergenic
1107725221 13:43292507-43292529 GCAAATGCAGGGCTGCAGGCAGG - Intronic
1108126098 13:47244592-47244614 GTAAATGGACAGCAGATGGTAGG - Intergenic
1110184448 13:72656867-72656889 GAAAAGGTACAGCTGTAGGTGGG + Intergenic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1114522114 14:23346469-23346491 GTGAATGCAAAGCAGCAGGGAGG + Exonic
1115876323 14:37865755-37865777 GTTATTGCACAATTGCAGGTGGG + Intronic
1116591449 14:46781107-46781129 GTAAAAGCACTACAGCAGGTTGG - Intergenic
1116788439 14:49313367-49313389 GAATATGCACAGCTCCAGATTGG - Intergenic
1118865710 14:69702011-69702033 GTGAGGGCACAGCTGCAGGGTGG + Intronic
1122708020 14:103633582-103633604 GTAAATGAGGAGCTGCAGGGAGG + Intronic
1124047249 15:26161678-26161700 GGATATGGACAGCTGCAGGAAGG + Intergenic
1124797341 15:32794641-32794663 GTATATGCATAACTGCAAGTAGG - Intronic
1125177758 15:36844891-36844913 GAAAGAGCACAGCTGCAGGAGGG + Intergenic
1126311240 15:47319394-47319416 GTAAATGGACAGCTGTAAGTAGG + Intronic
1126497335 15:49306681-49306703 GTCAATGCAGAGCTGCAAGAAGG - Intronic
1131835759 15:96389000-96389022 GTAAATGGAGAGCTCCAGCTTGG + Intergenic
1131983404 15:98017477-98017499 GCAAAGGCACTGCTGCAGGGAGG - Intergenic
1133019696 16:2961905-2961927 GCAGATGCACAGGTGCAGATTGG - Intergenic
1134202376 16:12209758-12209780 TTAAGTGCAGAGCAGCAGGTAGG - Intronic
1139326502 16:66156467-66156489 GGAAATGCACAGCTGCAGTCTGG + Intergenic
1141658507 16:85429143-85429165 ATACATGCAGAGGTGCAGGTGGG + Intergenic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1142609259 17:1099370-1099392 GTAAATGTGCAGGTGCAGGCCGG - Intronic
1143954819 17:10659992-10660014 GTACTTCCACAGCAGCAGGTCGG + Intergenic
1147137175 17:38441143-38441165 GCAAATACACAGCAGCAGGCAGG - Intronic
1148373307 17:47117635-47117657 GCAAATTCGCAGCTGCTGGTTGG + Intergenic
1148699571 17:49579486-49579508 GTCACTCCACAGCTTCAGGTTGG - Exonic
1151046994 17:70932387-70932409 GTATATGCACAACTCTAGGTGGG + Intergenic
1152601523 17:81264662-81264684 TAAAAAGCACAGCTGGAGGTGGG + Intronic
1153472982 18:5467910-5467932 CCAAATCCACAGCTGCAGCTGGG - Intronic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1157574066 18:48732107-48732129 GTGAATGCACTGCTGCAGCATGG - Intronic
1158676213 18:59520883-59520905 TTACATCCACTGCTGCAGGTAGG - Intronic
1159370896 18:67526587-67526609 GTAGCGGCACAGCTGCAGATAGG - Intergenic
1159874663 18:73797101-73797123 GTAAATGCTCTCCTGGAGGTGGG + Intergenic
1161055061 19:2186781-2186803 TGAAATCCACAGCAGCAGGTCGG - Intronic
1162775494 19:12976385-12976407 GTAAATGCACAGGGGTAGGTTGG + Intergenic
926693886 2:15757143-15757165 GTAAATCCACAAAAGCAGGTTGG + Intergenic
927398686 2:22685767-22685789 TCAAATGCACAGCTGCAGTCAGG + Intergenic
938195029 2:129319399-129319421 TCATATCCACAGCTGCAGGTTGG + Intergenic
939298266 2:140297942-140297964 CCCAGTGCACAGCTGCAGGTGGG + Exonic
941376918 2:164742518-164742540 GGCCATCCACAGCTGCAGGTGGG + Intronic
942516722 2:176761687-176761709 GGAAATGTATAGCTGCAGGAGGG + Intergenic
944534474 2:200695761-200695783 GCAAAGGCACAGCTGCAGATGGG - Intergenic
945978214 2:216287076-216287098 TTACAGGCACAGGTGCAGGTGGG - Intronic
949073141 2:242038899-242038921 GTTCATTCACAGCTCCAGGTGGG + Intergenic
1171266554 20:23776244-23776266 ATAAATGCACAGCTGCCTGCTGG - Intergenic
1171272341 20:23826735-23826757 ATAAATGCACAGCTGCCTGCTGG - Intergenic
1172480968 20:35271186-35271208 GCCAATGCAGAGCTGCCGGTAGG + Intronic
1174097987 20:48104721-48104743 GTAAATAGAAAGCTGCAGGAGGG - Intergenic
1174874107 20:54208672-54208694 GGAAATGGGCAGCTCCAGGTTGG - Intronic
1175524956 20:59627331-59627353 CTAAAAGCAGAGCTGCAGGCGGG - Intronic
1177608145 21:23408607-23408629 GTAAATGGAGAACTGCAGCTTGG + Intergenic
1180041055 21:45280352-45280374 GTAGATCCACAGCTGAAGATGGG - Intronic
1180945324 22:19689279-19689301 GTGGTTGCACAGTTGCAGGTGGG + Intergenic
1182168638 22:28203708-28203730 GTTAATCCACAGAGGCAGGTGGG - Intronic
1182276518 22:29192629-29192651 GCAAACGCACATCTGCAGGGCGG - Intergenic
1183167792 22:36160728-36160750 GCAGATGCACGGCTGGAGGTGGG - Exonic
1184961231 22:47930289-47930311 GTACATGCAAAGCTGGAGGTGGG + Intergenic
950012458 3:9732670-9732692 TTAAAGACACAGCCGCAGGTAGG + Intronic
950659445 3:14457834-14457856 GTAAATGCAGCGCCTCAGGTGGG + Intronic
951864610 3:27294264-27294286 GTGCAGGCACAGCTGCAGGCTGG - Intronic
952901117 3:38112285-38112307 GTCAATGCACAGCTGCTGGTAGG - Exonic
954481865 3:50806863-50806885 GCAACTGCACTGCTCCAGGTTGG - Intronic
955362007 3:58283697-58283719 GTTAATGCAGAGATGGAGGTTGG + Intronic
955629397 3:60956461-60956483 GAAAAAGCACAGCTAAAGGTAGG - Intronic
958752865 3:98213288-98213310 GAGAATGCACACCTGCGGGTGGG + Intergenic
962385874 3:134932262-134932284 CTGAATGCACAGCTGCTGCTTGG + Intronic
966301814 3:178487366-178487388 GCAACTGCCCAGCTGCAGGAAGG - Intronic
967110046 3:186285014-186285036 GCAAATGCCCAGCTGGGGGTGGG + Intronic
969869565 4:10096172-10096194 TTTAATGCACAGCTGCAGAGTGG + Intronic
972128493 4:35800945-35800967 CTAAGTCCACAGCTGCAGTTTGG - Intergenic
977814832 4:101403054-101403076 ATAAATACAAAGCTGCAGCTAGG + Intergenic
979936104 4:126698438-126698460 GTAAAACCACAGCTACAGGAGGG - Intergenic
981001716 4:139834710-139834732 TTAAATGCACTGCTTCATGTTGG - Intronic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
982117744 4:152112238-152112260 GTAAATCCAGAGCTGGGGGTGGG - Intergenic
984857334 4:184206194-184206216 GCATACGCACAGCTCCAGGTAGG - Intronic
987240498 5:15993633-15993655 GGTTATGCACAGCTGCAAGTAGG - Intergenic
989604682 5:43232656-43232678 GTAAATGGAGAACTGCAGCTTGG + Intronic
992849461 5:80791819-80791841 ATAAATGCACAGAAGAAGGTTGG + Intronic
994558168 5:101331115-101331137 GCAGGTGCAGAGCTGCAGGTGGG - Intergenic
995833414 5:116377803-116377825 GGAAGTGGACACCTGCAGGTGGG - Intronic
997385037 5:133465703-133465725 GTGGCAGCACAGCTGCAGGTGGG + Intronic
1000644107 5:163740291-163740313 GTAAATGGACAGCAGATGGTGGG - Intergenic
1003034468 6:2631205-2631227 AAACATGCACAGCTGCTGGTGGG - Intronic
1003157261 6:3607338-3607360 ATAAAGGCACAGCTGCGGGACGG - Intergenic
1005251606 6:23952443-23952465 GTAAATCCTCAGCTGCTGCTTGG - Intergenic
1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG + Intronic
1011671020 6:89683128-89683150 GTACCTGCCCAGCTGCTGGTTGG + Exonic
1012252088 6:96991262-96991284 GGAAATGCTCAGCTGGGGGTGGG + Intronic
1013469183 6:110446103-110446125 CTAAATGCAGAGCAGCAGGTTGG - Intronic
1017087901 6:150731158-150731180 CTAAATGCACGGCTGCTGATTGG + Intronic
1019180273 6:170182557-170182579 GAGAATCCACACCTGCAGGTGGG + Intergenic
1021810181 7:24395457-24395479 CTAAAGGCCCAGCAGCAGGTTGG + Intergenic
1023673527 7:42605274-42605296 GAAAATGCAGTGCTTCAGGTGGG + Intergenic
1023875050 7:44282346-44282368 GTGACTGCACAGCTGGAAGTGGG - Intronic
1024286095 7:47758855-47758877 GTATATGAAAAGCTGCAGCTGGG + Intronic
1025557795 7:62330722-62330744 GAAAACACAGAGCTGCAGGTTGG - Intergenic
1027533135 7:79361247-79361269 GTAAGTTCATAGCTACAGGTGGG + Intronic
1033429352 7:141274786-141274808 GCAAAGGCACAGCTGGAGGAGGG + Intronic
1035353818 7:158265336-158265358 GTGGATGCACACCTGCAGGCAGG + Intronic
1036014427 8:4766575-4766597 ATAAATGCCCTGCTGCATGTTGG - Intronic
1039486568 8:37914789-37914811 GAAAATGCAAAACTCCAGGTGGG - Intergenic
1040335973 8:46416181-46416203 GCAAAAACAAAGCTGCAGGTTGG + Intergenic
1042745653 8:72103074-72103096 GAAATTGCCCAGCTCCAGGTTGG + Intronic
1042784665 8:72535202-72535224 GGAAATGCAGAGCTGGAGCTTGG + Intergenic
1043564962 8:81537746-81537768 TCAAATGCACACCTGGAGGTGGG + Intergenic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1048419325 8:134261558-134261580 GTCAATGTACAGCTCCAGCTGGG + Intergenic
1049185834 8:141252640-141252662 GGAAATTCACAGACGCAGGTGGG - Intronic
1049185846 8:141252744-141252766 GGAAATTCACAGACGCAGGTGGG - Intronic
1051327232 9:15985823-15985845 GTAATTCCAAAGCTCCAGGTGGG - Intronic
1051746545 9:20300075-20300097 GTAAATACACAGATGATGGTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053108268 9:35432829-35432851 GTAAGGGCAGAGCTACAGGTTGG - Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055693161 9:78856021-78856043 TTAATGGGACAGCTGCAGGTGGG + Intergenic
1056084909 9:83137820-83137842 GTAAATGCTCAGAGGCAGGAGGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1060154662 9:121310924-121310946 ACAAATGCATAGATGCAGGTGGG + Intronic
1061480200 9:130894084-130894106 GTAAATCCACCGCTGCTGGCTGG + Intergenic
1062227814 9:135463457-135463479 GCCAATGCACAGCTGCTGCTGGG + Intergenic
1062631970 9:137467126-137467148 GAGAAGGCACAGATGCAGGTTGG - Intronic
1187285088 X:17897428-17897450 GGGAAGGCACAGTTGCAGGTAGG - Intergenic
1188656827 X:32707433-32707455 GCAAATGCACAGAAGCTGGTGGG + Intronic
1188907874 X:35809782-35809804 GTAGATGCACACCCGCATGTAGG - Intergenic
1189317054 X:40063858-40063880 TTCAATGCACACCTTCAGGTTGG + Exonic
1190309482 X:49106677-49106699 GGAACTGCACATCTCCAGGTGGG - Intergenic
1193990295 X:88299081-88299103 TTAAATACACAGCTGCAGTCAGG + Intergenic
1194380173 X:93181345-93181367 TCAAATCCACAGCTGCAGTTTGG - Intergenic
1197835236 X:130687022-130687044 GTAGAGGCATGGCTGCAGGTGGG + Intronic
1200250670 X:154552241-154552263 GGAAACGCAGAGGTGCAGGTGGG - Intronic
1200838392 Y:7755130-7755152 GTAATAGATCAGCTGCAGGTAGG - Intergenic