ID: 1047991627

View in Genome Browser
Species Human (GRCh38)
Location 8:130292421-130292443
Sequence GCTTTGTAAAGCCTTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047991627_1047991634 10 Left 1047991627 8:130292421-130292443 CCAGAGGGAAGGCTTTACAAAGC 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1047991634 8:130292454-130292476 TGAGTTGGGCTTTACAGAAGAGG No data
1047991627_1047991632 -4 Left 1047991627 8:130292421-130292443 CCAGAGGGAAGGCTTTACAAAGC 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1047991632 8:130292440-130292462 AAGCAGGGGTCCTTTGAGTTGGG No data
1047991627_1047991631 -5 Left 1047991627 8:130292421-130292443 CCAGAGGGAAGGCTTTACAAAGC 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1047991631 8:130292439-130292461 AAAGCAGGGGTCCTTTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047991627 Original CRISPR GCTTTGTAAAGCCTTCCCTC TGG (reversed) Intronic
901233408 1:7653832-7653854 GCTTGGCAAGGCCTGCCCTCAGG + Intronic
901401413 1:9017443-9017465 CCTCTGTACAGCCTTCCTTCTGG - Intronic
902659442 1:17891035-17891057 GCTTGGCAAAGCCCTCCCTCTGG + Intergenic
907133423 1:52117482-52117504 GCTTAAGAAAGCCATCCCTCTGG - Intergenic
908842352 1:68292983-68293005 TCTTTCTAAAGGCTTCACTCTGG - Intergenic
910091287 1:83467309-83467331 GCTTTTACAAGCCTTCCCTTGGG - Intergenic
910924092 1:92380578-92380600 TGTTAGTAAAGCCTTCTCTCTGG + Intronic
916187678 1:162148728-162148750 GCTTTGTAAAGAGATCACTCTGG + Intronic
916346879 1:163802489-163802511 GCATTGTGAAGGCTTCACTCTGG + Intergenic
916799061 1:168197377-168197399 GCTTTCTAAACCCTTCACTTAGG + Intronic
921236512 1:213137242-213137264 CCTTGGTAAAGCCTTCCTACTGG - Intronic
924592867 1:245420110-245420132 ACTTTGTAGAGGCATCCCTCTGG + Intronic
1062849152 10:729629-729651 GCACTGTACAGCCCTCCCTCGGG - Intergenic
1063475068 10:6321106-6321128 TCTTCTCAAAGCCTTCCCTCTGG + Intergenic
1063537804 10:6901882-6901904 GCTTTCCAAACCTTTCCCTCAGG + Intergenic
1065313670 10:24441006-24441028 GCTTTGTTGAGCCCTGCCTCTGG + Intronic
1066186976 10:33019438-33019460 GGTTTTTAGAGCTTTCCCTCAGG - Intergenic
1072566908 10:96624357-96624379 GCATTGTAGAGCCATCCCTTGGG - Intronic
1073782745 10:106857238-106857260 GCTTTCTAAAGCCTTACCGAAGG - Intronic
1074447754 10:113534312-113534334 ACTTTTCAAAGCCTTCCCCCTGG + Intergenic
1075189669 10:120295256-120295278 GCTTTATGAAGTCTTCCTTCTGG + Intergenic
1075298777 10:121301553-121301575 GCTTTGTAAATCCCTCACTATGG + Intergenic
1078465711 11:11548570-11548592 GCTTTCAGAGGCCTTCCCTCTGG - Intronic
1079216210 11:18514207-18514229 GCTTTCCAAAGCCTTCCAACAGG + Intronic
1080136884 11:28865408-28865430 CCTTTGCAAAGCCTGCCTTCTGG + Intergenic
1080234272 11:30050968-30050990 GCTTTGTAATTTCTTGCCTCTGG - Intergenic
1080896351 11:36451675-36451697 GCTTTGTTACACCCTCCCTCTGG + Intronic
1088773008 11:113054384-113054406 GCATTTTAAAGCCTTACCTGAGG + Intronic
1090126716 11:124093932-124093954 CATTTGTAAAACCTACCCTCTGG + Intergenic
1093766049 12:22964097-22964119 CCTTTGCCAAGCCTTCCCCCTGG + Intergenic
1094368649 12:29711637-29711659 GCTTTTTAAAGTCCTGCCTCTGG - Intronic
1098507843 12:71275348-71275370 GTTTTCTAAAGCCTTTGCTCTGG + Intronic
1100849693 12:98696396-98696418 GCCTTCTAATGCCTTCCCACTGG - Intronic
1103303108 12:119943165-119943187 GCTTTGTCAAGCCTGCACTGTGG + Intergenic
1104697642 12:130875643-130875665 ACTTTGAAAAGCCCTTCCTCTGG + Exonic
1104918648 12:132279198-132279220 GCCTTGTTAGGCCTTCCCTGTGG - Intronic
1105288283 13:19026370-19026392 TTTTTGTAAAGCTTTCCCTGGGG + Intergenic
1105370104 13:19794786-19794808 TCTTTGTGTAGCATTCCCTCAGG + Intergenic
1108924672 13:55726221-55726243 CCTTAGCAAAGCCTGCCCTCAGG + Intergenic
1109058945 13:57587788-57587810 GCTTTGGAAAAACTTCCCTATGG - Intergenic
1114161546 14:20173794-20173816 TTTTTGTAAAGCTTTCCCTGGGG + Intergenic
1115755772 14:36524985-36525007 GCTTTGTAACCCGCTCCCTCAGG - Intergenic
1123969772 15:25496288-25496310 GAATTGCAAAGTCTTCCCTCTGG - Intergenic
1124224924 15:27885371-27885393 GGTTTGGAAAGCCTTCCCATGGG - Intronic
1124942895 15:34234843-34234865 GCTTTGCAAAGCCTTTCTTTTGG - Intronic
1125356262 15:38820067-38820089 ACTTTGTCAAGACTTCTCTCAGG - Intergenic
1126982194 15:54256748-54256770 GCTTTGGAATGCATTCCCTGAGG + Intronic
1129751329 15:78066733-78066755 GCTCTGTAAGGCATACCCTCTGG - Intronic
1132735128 16:1382148-1382170 GCTGTGTTAAGCTTTCTCTCAGG - Intronic
1133426926 16:5700356-5700378 TCTTTGTATTGCCTTCTCTCTGG + Intergenic
1138165809 16:54800700-54800722 GCTTGGGAAAGCCTTTCTTCTGG + Intergenic
1138214150 16:55188572-55188594 GCTTTGTAATGCTTGGCCTCGGG + Intergenic
1138904454 16:61314045-61314067 TCTTAGTAAAGTCTGCCCTCAGG + Intergenic
1141673342 16:85504382-85504404 GCTTTGGAAAGCCAGACCTCTGG - Intergenic
1141718202 16:85739176-85739198 GCTCTGTGCAGCTTTCCCTCTGG - Intronic
1144792546 17:17868704-17868726 CATTTCCAAAGCCTTCCCTCAGG - Intronic
1152386027 17:79975312-79975334 GCTTTGTACAGCCTGAGCTCTGG + Intronic
1156943944 18:42804145-42804167 GCTTTGTAAAAACTTCCCTTGGG - Intronic
1158043748 18:53130280-53130302 GCTTTTTAAAGTCTTTACTCTGG + Intronic
1165639753 19:37374210-37374232 GCTTTGTAAAGCCATGTCCCAGG + Exonic
925022665 2:583961-583983 GCTCTGTCGAGCCTTCCCCCAGG - Intergenic
925176574 2:1788699-1788721 CCTTTGTAGAGCCTTTCTTCTGG - Intergenic
925756439 2:7136838-7136860 GCTTTGTAAAACCTGCAGTCAGG - Intergenic
935127204 2:100235184-100235206 ACGTTGTAAAGCCGGCCCTCTGG - Intergenic
935151663 2:100442389-100442411 CCTTTGAAAGGCCTTTCCTCAGG - Intergenic
935264728 2:101384568-101384590 GCTTTTTTAAACCTTCTCTCAGG - Intronic
936072360 2:109379755-109379777 ACTTTGTAAAGCCCTCCTGCAGG + Intronic
936434799 2:112495215-112495237 GATTAGAAAAGCCTTCCCTGAGG - Intronic
937225236 2:120365091-120365113 TCTTTGAAAAGTCTTCCCTGAGG + Intergenic
937682015 2:124654200-124654222 GCTTTGTAAAATCTGGCCTCTGG - Intronic
937854185 2:126660724-126660746 CCTTTAAAAAGCCTTCACTCAGG + Intronic
944512297 2:200476683-200476705 GCATTGTAACGCATGCCCTCTGG - Intronic
945767233 2:213996094-213996116 GCTTTGTAATTCCTTGCCTCTGG - Intronic
948646905 2:239411091-239411113 GGTTTGCAAAGCCTTGGCTCAGG + Intergenic
1172663867 20:36585944-36585966 GCTTTGGGAAGGCTTCCCTCAGG - Intronic
1173931561 20:46824733-46824755 GCTTTGTGAAGCCTTATTTCTGG - Intergenic
1175342977 20:58246576-58246598 GTTTTCTAATGCCTGCCCTCTGG - Intergenic
1177794713 21:25761715-25761737 GTTCTGTAAAGCCTTATCTCAGG + Intronic
1178772026 21:35514402-35514424 GCTTTGTAAAGTTTTCCTGCTGG + Intronic
1182100917 22:27656607-27656629 ACCTTCTAAAGCCTTCCCACTGG - Intergenic
1183260237 22:36790118-36790140 GCTCTTTAAAGCCCTCCCACTGG - Intergenic
1184827451 22:46962671-46962693 GCTCTTTGAAGCCATCCCTCAGG - Intronic
949875644 3:8624470-8624492 GCTTTTTAAAGGCTCACCTCAGG - Intronic
954937197 3:54337358-54337380 GCTCTGCCAAGCTTTCCCTCTGG - Intronic
956699277 3:71944542-71944564 CCTTGGTAAAGACTTCACTCTGG + Intergenic
963874681 3:150462190-150462212 GCTTGGAACACCCTTCCCTCTGG - Exonic
965114839 3:164476463-164476485 TCTTAATAAGGCCTTCCCTCAGG - Intergenic
966207811 3:177422762-177422784 GCTTTGAAAAGCCTTGACTTAGG + Intergenic
966592825 3:181700538-181700560 GCTCTGTAATTCCTTCTCTCAGG - Intergenic
970122675 4:12774513-12774535 GCTATGTAGAGCCTTCGGTCAGG + Intergenic
970508195 4:16754372-16754394 GCATTGAAAAGGCTTCCCACTGG - Intronic
971206041 4:24569998-24570020 TCTTTCTCAAGTCTTCCCTCTGG - Intronic
971448757 4:26779980-26780002 GCTAGGTAAGGGCTTCCCTCTGG + Intergenic
973310382 4:48703429-48703451 GCTTTGTAAAGAGATCACTCTGG - Intronic
976616170 4:87079833-87079855 GCTTTATACAGAATTCCCTCAGG + Intronic
978881385 4:113707368-113707390 ACATTATAAAGCATTCCCTCAGG - Intronic
979687922 4:123531308-123531330 GCATTGCTAAGCCTTCCCCCAGG - Intergenic
982309289 4:153967560-153967582 CCTTTGGAAAGCCTTCCTTTAGG - Intergenic
982613970 4:157616433-157616455 GCATTGAAAAGCCTTTGCTCTGG + Intergenic
987077555 5:14398205-14398227 GCTTAGTAAAGCCAGCCCTAGGG - Intronic
990994520 5:61718123-61718145 GGCATGTAAAGCCTTCTCTCGGG - Intronic
991484551 5:67120864-67120886 GCTCTGTAAAGCTATCCCTCAGG + Intronic
992069815 5:73138037-73138059 GCTTTGGAAACCTTTCCCTCTGG + Intergenic
992284028 5:75214119-75214141 GCCTTTTAGAGCGTTCCCTCTGG + Intronic
1001145379 5:169179337-169179359 TTTTTGTAAAGCCTTCACTAAGG + Intronic
1002803011 6:544249-544271 GCTTTGTGAAACCTTTTCTCAGG + Intronic
1005838848 6:29727068-29727090 GCCTTGCAAAGCCTTCGCTTTGG + Exonic
1005931291 6:30486406-30486428 ACTTTGAAAAGCCCTTCCTCTGG + Intergenic
1007681809 6:43638909-43638931 GGATTGGAAAGTCTTCCCTCTGG + Intronic
1011853317 6:91657610-91657632 GCTTTGGAAATTCTTCTCTCAGG - Intergenic
1012448944 6:99334716-99334738 GCATTGTAAACAGTTCCCTCTGG - Intronic
1014795307 6:125717882-125717904 GTTTTCTAAAGCCTTCCTTTAGG - Intergenic
1016636025 6:146291405-146291427 ACTTTGTAAAGCCTTCCTTGAGG + Intronic
1017685029 6:156904611-156904633 GCTTTGTAAAGCCATGCTACTGG - Intronic
1020864399 7:13539089-13539111 GCTTTGTGAATCTCTCCCTCAGG - Intergenic
1021653407 7:22853124-22853146 GCTTTGTTAAGGCATCCCTAGGG - Intergenic
1027308130 7:76923758-76923780 GCTTTTACAAGCCTTCCCTTGGG - Intergenic
1029381567 7:100218787-100218809 GCTCTTTAGAGCCTTCCCTCGGG + Intronic
1029401003 7:100346114-100346136 GCTCTTTAGAGCCTTCCCTCGGG + Intronic
1031470319 7:122160700-122160722 GCTTTGTTCAGACTTCCCTTTGG - Intergenic
1032517516 7:132518251-132518273 GCTGTGTCAACCCTACCCTCTGG - Intronic
1032908329 7:136399543-136399565 GTTTTGTAAATGCTTCCCTAGGG + Intergenic
1033981159 7:147167395-147167417 ACTTTGAAAAGCCCTTCCTCTGG + Intronic
1034245959 7:149644615-149644637 GCAGTGAAAACCCTTCCCTCTGG + Intergenic
1036616906 8:10395159-10395181 GCTCTGCAAAGTCTTCCCCCCGG - Intronic
1038481081 8:27902232-27902254 GCTCTGGACAGCCTCCCCTCAGG - Intronic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1044515727 8:93136188-93136210 AATTTGAAAAGCCTTCCCACAGG + Intronic
1047991627 8:130292421-130292443 GCTTTGTAAAGCCTTCCCTCTGG - Intronic
1052801661 9:32973784-32973806 GCTTAGTTTAGACTTCCCTCAGG + Intronic
1052975710 9:34408425-34408447 CCTTTAAAAAGCCTTCCCTCTGG - Intronic
1057020521 9:91693762-91693784 GCTCAGTAACTCCTTCCCTCAGG - Intronic
1057966232 9:99506119-99506141 GCTTTTGAAAGCATTCCCTTTGG + Intergenic
1059168188 9:112098811-112098833 GCTTTGTCAAGTCCTTCCTCAGG - Intronic
1188220476 X:27535429-27535451 GCTTTTTAAAGCCATCACTCTGG - Intergenic
1188582269 X:31728606-31728628 GCTATGTTAACCCTTCCCTAAGG - Intronic
1189287598 X:39862766-39862788 GCCTCCTAAAGCCTGCCCTCAGG + Intergenic
1189851295 X:45178710-45178732 ACTTTGTAAAAATTTCCCTCAGG + Intronic
1191885568 X:65884398-65884420 GCTTCGTAAAGCCTTCTTCCAGG - Intergenic
1193105085 X:77662067-77662089 TCTTTGTGAAGCCTTCTCTGGGG + Intronic
1196131705 X:112164246-112164268 GCATGGTAAACCCTTCCCACAGG + Intergenic
1197341859 X:125284931-125284953 TCTTAATAAAGCCTGCCCTCAGG - Intergenic
1197905212 X:131417554-131417576 CCTTTGTAAAGTCCTCTCTCTGG - Intergenic
1198454926 X:136807385-136807407 ACTTTGAAAAGCCCTTCCTCTGG - Intergenic
1198919900 X:141713805-141713827 GCTCTCTAAACACTTCCCTCCGG + Intergenic