ID: 1047993935

View in Genome Browser
Species Human (GRCh38)
Location 8:130315628-130315650
Sequence CTGGAGTGCCTCCATTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047993927_1047993935 14 Left 1047993927 8:130315591-130315613 CCACTTGTTGCTTCCCAGCTGTG 0: 1
1: 0
2: 3
3: 16
4: 267
Right 1047993935 8:130315628-130315650 CTGGAGTGCCTCCATTAGCAGGG No data
1047993929_1047993935 1 Left 1047993929 8:130315604-130315626 CCCAGCTGTGCTCCCATGAGGTG 0: 1
1: 0
2: 3
3: 13
4: 161
Right 1047993935 8:130315628-130315650 CTGGAGTGCCTCCATTAGCAGGG No data
1047993930_1047993935 0 Left 1047993930 8:130315605-130315627 CCAGCTGTGCTCCCATGAGGTGT 0: 1
1: 0
2: 1
3: 14
4: 127
Right 1047993935 8:130315628-130315650 CTGGAGTGCCTCCATTAGCAGGG No data
1047993926_1047993935 26 Left 1047993926 8:130315579-130315601 CCAAGAAATAGACCACTTGTTGC 0: 1
1: 0
2: 0
3: 15
4: 101
Right 1047993935 8:130315628-130315650 CTGGAGTGCCTCCATTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047993935 Original CRISPR CTGGAGTGCCTCCATTAGCA GGG Intronic
No off target data available for this crispr