ID: 1047994592

View in Genome Browser
Species Human (GRCh38)
Location 8:130321830-130321852
Sequence AGAGCCTTGAATCTCATACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047994592 Original CRISPR AGAGCCTTGAATCTCATACT AGG (reversed) Intronic
906351424 1:45063467-45063489 AGGGCCTTGAATGGCATGCTAGG - Intronic
908015311 1:59826615-59826637 ATAGCATAGAATCACATACTTGG + Intronic
908698921 1:66876861-66876883 GGAGCCATGATTGTCATACTAGG - Intronic
909680304 1:78284523-78284545 AGAGCCCAGAATCTCTAACTAGG - Intergenic
910185885 1:84539185-84539207 AGAGCCGTGATTCTCCTACCAGG - Intergenic
913698293 1:121349091-121349113 AGAGCCTCGAATGCCAAACTTGG + Intronic
914139256 1:144930949-144930971 AGAGCCTCGAATGCCAAACTTGG - Intronic
915122276 1:153637057-153637079 AGGCCCTTGAATGTCATTCTTGG + Intronic
917255847 1:173115341-173115363 AGAGCCTGGGATCTCCCACTTGG - Intergenic
917499965 1:175577155-175577177 AGAGTCTTGAATCTCAGGCTAGG + Intronic
918542906 1:185650633-185650655 AGAGCTTTGAATCACATGTTAGG + Intergenic
918675812 1:187283955-187283977 AGAACTTGGAATCTCATACGGGG + Intergenic
920274712 1:204795492-204795514 AGAACCCGGAATCTCTTACTGGG + Intergenic
920485692 1:206367747-206367769 AGAGCCTCGAATGCCAAACTTGG + Intronic
920978788 1:210811943-210811965 AGAGCCTTTAAACCCATTCTGGG + Intronic
922248452 1:223823534-223823556 AGAGCTTTTGAGCTCATACTGGG - Intronic
922315972 1:224442292-224442314 AGAGCCTGGCCTCTCTTACTGGG + Intronic
1063223178 10:3990008-3990030 AGAGCATTAAATCTTATACATGG - Intergenic
1063580461 10:7301730-7301752 AGAGGCGTGGCTCTCATACTAGG - Intronic
1065123673 10:22552590-22552612 AGAACCTTGCATTTCATTCTTGG - Intronic
1071273046 10:84026602-84026624 AGAGGCTTTAATCTCAGCCTTGG - Intergenic
1072794473 10:98343931-98343953 AGAGCCTTGAATCTGCTACTGGG + Intergenic
1072950362 10:99841580-99841602 AGATTCTTGAATCCCATCCTAGG + Intronic
1077676639 11:4200238-4200260 AGAGACTTAAATCTAAGACTTGG - Intergenic
1078878143 11:15419018-15419040 AGAGGCTTGAATGCCAGACTAGG + Intergenic
1081570495 11:44287650-44287672 TGAGACTTGAATCTCATGCCTGG + Intronic
1081961769 11:47143089-47143111 AGAAGCTTGATGCTCATACTCGG - Intronic
1086901255 11:92370367-92370389 ACAACCTCGGATCTCATACTTGG - Intronic
1090411892 11:126515005-126515027 ACAGCCTAGAATCACATACTGGG - Intronic
1090982887 11:131738930-131738952 AGACCATAGAATCTCATTCTGGG - Intronic
1091015647 11:132048930-132048952 TCAGCCTTGAATCTCCTACAGGG - Intronic
1092882355 12:12897545-12897567 AAGGCCTTGAAGCTCAAACTGGG + Intronic
1093157874 12:15709732-15709754 AGAGCCGTGAATATCAATCTTGG - Intronic
1094736274 12:33237924-33237946 AAAGTCTTGAATGTCATACATGG + Intergenic
1098135689 12:67399434-67399456 AATGCCTTGCATTTCATACTTGG + Intergenic
1098159591 12:67636926-67636948 AAAGCTTTCAATCTCATGCTTGG + Intergenic
1098384852 12:69907938-69907960 AGGGCCTTGCAGGTCATACTTGG - Intronic
1099095906 12:78374153-78374175 AAAGCTTTGAATTTCATGCTAGG - Intergenic
1100412474 12:94334580-94334602 TTACCCTTGAATCTCATAATAGG - Intronic
1101438703 12:104686456-104686478 AGAAACTTGAATCTGGTACTAGG + Intronic
1103120798 12:118377622-118377644 AGAGCCTTGCTTTTCAAACTGGG + Intronic
1105966754 13:25391630-25391652 AGTGCCTTGAATATCATAAGAGG + Intronic
1110166808 13:72452355-72452377 TGAGCCCGGAATCTCACACTTGG - Intergenic
1113225668 13:108157152-108157174 AGAGCCCTGAATCTCTTTCTTGG + Intergenic
1114137768 14:19871740-19871762 AGAACATTGAATCTCAGATTTGG + Intergenic
1115215631 14:31011350-31011372 AGACCCTTTACTCTCAAACTGGG + Intronic
1116668364 14:47808147-47808169 AGAGCCATGAAACTAATTCTAGG - Intergenic
1117249407 14:53921341-53921363 AAATGCTTAAATCTCATACTGGG + Intergenic
1117946160 14:61024146-61024168 AGAGCCTTGTGACTAATACTTGG - Intronic
1122953685 14:105060237-105060259 AGAGCCCTGCATCTCTTGCTGGG - Intronic
1128347071 15:66861053-66861075 AGAGCCAGGAAGCTCAGACTTGG - Intergenic
1128680644 15:69648990-69649012 AGAGCCTTGATTCTCACTGTGGG - Intergenic
1131408560 15:92186657-92186679 AATCCCTTGAATCTCATACTTGG - Intergenic
1131863097 15:96675596-96675618 AAAGCCTTGAGTGTCATTCTAGG + Intergenic
1132109106 15:99089208-99089230 AAAGACTTGACTCTCAGACTGGG + Intergenic
1133072927 16:3258491-3258513 AAAGCCTTGAATCCCAGGCTGGG - Intergenic
1134138561 16:11696967-11696989 AGAGCCTTAAAGCTCATTGTAGG - Intronic
1134572226 16:15300851-15300873 AGAGCCAAGAGTCTCAAACTAGG - Intergenic
1134572290 16:15301500-15301522 AGAGCCAAGAGTCTCAAACTAGG - Intergenic
1134730090 16:16454548-16454570 AGAGCCAAGAGTCTCAAACTAGG + Intergenic
1134730155 16:16455197-16455219 AGAGCCAAGAGTCTCAAACTAGG + Intergenic
1134937276 16:18256702-18256724 AGAGCCAAGAGTCTCAAACTAGG - Intergenic
1134937342 16:18257352-18257374 AGAGCCAAGAGTCTCAAACTAGG - Intergenic
1137505687 16:49051915-49051937 AGAGCCAGGAATCTCAGGCTTGG - Intergenic
1137830452 16:51538754-51538776 AGAGCCTTGCATCACAGGCTAGG - Intergenic
1137885596 16:52100018-52100040 AGAGCAGTGAATCTCAATCTTGG - Intergenic
1144107558 17:11999336-11999358 ACAGCCTTGAAACCCATCCTTGG + Intergenic
1145206550 17:20987471-20987493 AGAGACTTGAGTCTCAAATTTGG + Intergenic
1146621448 17:34401632-34401654 ACAGACTTGAATTTCAGACTGGG - Intergenic
1157048595 18:44133236-44133258 AGAGTCATAAATCCCATACTTGG - Intergenic
1157402101 18:47397178-47397200 AGAGACTTCAATCTCTGACTAGG - Intergenic
1159799417 18:72879016-72879038 TGAGACTTGAACCTCATAATTGG - Intergenic
1163432949 19:17279097-17279119 AAAGCCTTGGTTCTCAAACTGGG + Exonic
1164128665 19:22341772-22341794 AGAGCTGTGACTCTCACACTTGG + Intergenic
1166105380 19:40595561-40595583 AGAGCTTTGAGTCTCAAGCTGGG + Intronic
929167034 2:38893027-38893049 AGAGCCTTGAATCTCTTCTTTGG - Intronic
931577511 2:63734239-63734261 AGAACCTTATATCACATACTTGG - Intronic
933297922 2:80511587-80511609 AAATCCTTGAATCTCAAAATAGG + Intronic
937851578 2:126640702-126640724 TGAACCTTAAATCTTATACTTGG - Intergenic
939867439 2:147488642-147488664 AGAGCCTGGAATCCCAGCCTGGG - Intergenic
941887668 2:170545940-170545962 AAAGCCTTGAAGGTCATGCTGGG - Intronic
945740718 2:213657646-213657668 AGAGTTTTGAATCTCTTCCTTGG + Intronic
947656811 2:231834470-231834492 AGAGCAGTGTATCTCACACTGGG - Intergenic
947657641 2:231841383-231841405 AGAGCAGTGTATCTCACACTGGG - Intergenic
947658110 2:231845465-231845487 AGAGCAGTGTATCTCACACTGGG - Intergenic
947658271 2:231846842-231846864 AGAGCAGTGTATCTCACACTGGG - Intergenic
1168863431 20:1063060-1063082 AGAGCCTTGTTTCTCAGCCTTGG + Intergenic
1172807593 20:37623466-37623488 AGAGCCTTGAATGCCAGCCTAGG - Intergenic
1177051035 21:16234224-16234246 AGATCCTTAAATCTTATATTTGG - Intergenic
1178392050 21:32206696-32206718 AGAGCCTTGACTTTCACACTTGG - Intergenic
1182060032 22:27390483-27390505 AGAACCTTGAATATAAAACTAGG - Intergenic
950707189 3:14790175-14790197 AGAGTCCTGGATCTCAGACTGGG - Intergenic
951149043 3:19265562-19265584 GGAGCCTGGAATCTAATGCTTGG + Intronic
952101901 3:30023439-30023461 ATACCTCTGAATCTCATACTTGG + Intergenic
953164622 3:40453715-40453737 AGTGCCTTGAATGCCAGACTAGG + Intergenic
953475912 3:43205832-43205854 TGAGGGATGAATCTCATACTAGG + Intergenic
956783114 3:72620070-72620092 AGAGCCTTGATACTCAAAGTTGG + Intergenic
957218249 3:77349129-77349151 AGAGCCTTGAATATAATAGGTGG + Intronic
958040270 3:88219149-88219171 AGAGCCCTGAATGTCATCGTGGG + Intergenic
958143964 3:89600280-89600302 AGCAGCTTGAATCTCTTACTTGG + Intergenic
962280934 3:134051292-134051314 AGAGCGTTGGTGCTCATACTTGG + Intronic
962611601 3:137081881-137081903 AAAGCATTGATTCTCATACTTGG + Intergenic
963769086 3:149370524-149370546 TTAGCCTTGAATTTCATACAAGG - Intronic
967218791 3:187232018-187232040 AGAGACTTGAAACTCACACATGG + Intronic
967569870 3:191016093-191016115 GCAGCCTGGAAGCTCATACTGGG - Intergenic
967899497 3:194435026-194435048 AGAGACTAGAATTTCAGACTTGG + Intronic
968870219 4:3238360-3238382 AGGGCCTTGGCTCTAATACTGGG - Intronic
970328737 4:14956708-14956730 AGAGCCATGTCTCTCAAACTGGG + Intergenic
970727984 4:19069780-19069802 AGACTCTTGAAACTCATTCTTGG - Intergenic
971841354 4:31856262-31856284 AGATCCTGGATTGTCATACTGGG - Intergenic
974092524 4:57327056-57327078 AGAGCCTTGAATCGCATTCATGG + Intergenic
975853050 4:78593165-78593187 AGAGCCTTTAATATCACAGTTGG + Intronic
982245673 4:153347928-153347950 AGGGCCTTGTATATCATACTGGG + Intronic
983550934 4:169016740-169016762 AGAGCTTTACATCTGATACTGGG - Intergenic
986022303 5:3815776-3815798 AGAGACTTGAATCTGAATCTGGG + Intergenic
986324653 5:6663231-6663253 AGAGCCCTGAATCCCCTGCTTGG - Intronic
986660009 5:10051335-10051357 TGAGCCTTGTGTCTCCTACTAGG - Intergenic
986698613 5:10381514-10381536 ATAGCCATGAACCTCATACAAGG - Intronic
988409396 5:30867436-30867458 AGAACATTGAAACACATACTGGG + Intergenic
988982890 5:36589103-36589125 AGAGCCTTGAAAGTCATAGGAGG - Intergenic
990751439 5:59021094-59021116 AGAGCCTTGAAGGTCATCCAGGG + Intronic
993110862 5:83655967-83655989 AAAGTCTTGAATCTGATAATTGG + Intronic
993218347 5:85056257-85056279 AGAGCATTGAATAGCATACTGGG - Intergenic
996394744 5:123002312-123002334 AGAGCCTTGAATTTGAACCTTGG - Intronic
997191766 5:131944490-131944512 AGGGCCTTGAATTTCTGACTTGG - Intronic
999936457 5:156491888-156491910 TGAGCCTGGCATCTCATTCTGGG + Intronic
1001185976 5:169573104-169573126 AGTTCCTTGGATCTTATACTGGG - Intergenic
1003600472 6:7512255-7512277 AGAGCCTTGGCTCTCAACCTTGG - Intergenic
1003909187 6:10727915-10727937 GGAGCCTTGAAGGCCATACTGGG - Intronic
1004428899 6:15525640-15525662 AGAGACTGAAATCTCAAACTCGG + Intronic
1004627737 6:17393201-17393223 AGAGCCTTTATCCTCATATTGGG + Exonic
1007366068 6:41394029-41394051 AGAACATTTAATCTCCTACTGGG - Intergenic
1014824908 6:126038392-126038414 ATAGCCTTGACTCTGTTACTTGG + Intronic
1014976824 6:127896850-127896872 AGAGCCATGGTTCTCAAACTTGG - Intronic
1015165926 6:130200043-130200065 GAGGCCTTGAATCTCACACTGGG - Intronic
1016236265 6:141870835-141870857 AGAGCTTTGAATATCATAATAGG - Intergenic
1017343661 6:153355595-153355617 AGAGACTTTAGTCTTATACTTGG - Intergenic
1023646950 7:42327592-42327614 AGAGCTTTGACTCTGATCCTGGG + Intergenic
1023839233 7:44086645-44086667 AGAGCAGTGAATCTCAACCTTGG - Intergenic
1030110603 7:106023449-106023471 AGAGCCTTGAATCTGACAACAGG + Intronic
1030823795 7:114129241-114129263 AAATCCTTGAATTTCATTCTGGG - Intronic
1033812418 7:145031269-145031291 AGAGCCTATAATTTCATAATTGG + Intergenic
1035193821 7:157197952-157197974 AAAGCCTTGAACCTCAATCTAGG + Intronic
1035837896 8:2775027-2775049 AGAGCTTTCAATCTGAGACTGGG - Intergenic
1041491707 8:58439721-58439743 AAAGCCTTGAACCTCAATCTAGG - Exonic
1042415221 8:68510673-68510695 ATAGACTTTAATCTTATACTTGG + Intronic
1044912222 8:97072377-97072399 GGGGCCTTGAATGCCATACTTGG - Intronic
1047994592 8:130321830-130321852 AGAGCCTTGAATCTCATACTAGG - Intronic
1050126891 9:2366661-2366683 ATAGCTTTGACTTTCATACTAGG - Intergenic
1052432319 9:28382559-28382581 AAAGCCTTGAATCTCATGGGGGG + Intronic
1052987422 9:34497958-34497980 AGGGCCTTGAATATCATGCAAGG + Intronic
1054956677 9:70919210-70919232 AGAGCCTTGATTTCCATGCTAGG - Intronic
1058187762 9:101875500-101875522 AGAGCGCTGATTCTCAAACTTGG + Intergenic
1058675868 9:107399476-107399498 AGAGATTTGAATCTCAGCCTTGG + Intergenic
1059692993 9:116703787-116703809 GGAGACCTGAGTCTCATACTAGG - Intronic
1060561156 9:124544785-124544807 AGAGCCTTGAATGCCAGACTAGG + Intronic
1187426799 X:19184859-19184881 AGGGCCTTGAAACTCAAAATTGG - Intergenic
1187720129 X:22141231-22141253 AGAGCAATGGTTCTCATACTTGG - Intronic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1191592839 X:62906622-62906644 ACAGCCAGGAAGCTCATACTGGG - Intergenic
1191858512 X:65646980-65647002 AGGGCCTTGTACCTCATACTAGG - Intronic
1193347849 X:80424724-80424746 ATAGACTTTAGTCTCATACTTGG + Intronic
1193602124 X:83520433-83520455 AGAGCCCTCAATCCCACACTGGG + Intergenic
1195999890 X:110771017-110771039 AGTGCCTATAATCCCATACTCGG + Intronic
1199949582 X:152697731-152697753 ACAGCCTTGAGTCTCACCCTGGG - Intergenic
1199960093 X:152770730-152770752 ACAGCCTTGAGTCTCACCCTGGG + Intergenic