ID: 1047995119

View in Genome Browser
Species Human (GRCh38)
Location 8:130327346-130327368
Sequence CTCCAACTGGACCTCAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047995115_1047995119 19 Left 1047995115 8:130327304-130327326 CCAAAATTGTTGGGCAAGCTGCT 0: 1
1: 0
2: 1
3: 14
4: 113
Right 1047995119 8:130327346-130327368 CTCCAACTGGACCTCAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047995119 Original CRISPR CTCCAACTGGACCTCAGTGT AGG Intronic
No off target data available for this crispr