ID: 1047995844

View in Genome Browser
Species Human (GRCh38)
Location 8:130335005-130335027
Sequence CAGTGTGGCCAGAGAGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047995844_1047995848 0 Left 1047995844 8:130335005-130335027 CCAAATTCTCTCTGGCCACACTG 0: 1
1: 1
2: 3
3: 25
4: 267
Right 1047995848 8:130335028-130335050 CTCTGTCACTGGGTATGAGACGG No data
1047995844_1047995846 -10 Left 1047995844 8:130335005-130335027 CCAAATTCTCTCTGGCCACACTG 0: 1
1: 1
2: 3
3: 25
4: 267
Right 1047995846 8:130335018-130335040 GGCCACACTGCTCTGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047995844 Original CRISPR CAGTGTGGCCAGAGAGAATT TGG (reversed) Intronic
900531670 1:3156862-3156884 CCGTGTGGCCTGAGAGAAGCAGG + Intronic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
904333683 1:29783838-29783860 CCGTGGGGCCAGTGAGACTTAGG - Intergenic
904367311 1:30022475-30022497 CTATTTTGCCAGAGAGAATTAGG - Intergenic
904752041 1:32747027-32747049 CTGAGTGGCCAGAGGGAACTTGG - Intronic
904924824 1:34039227-34039249 CAGCTTGGCCAGGGAGATTTGGG + Intronic
905713012 1:40123361-40123383 CAGTGTGCCCAAAGAGGATTAGG + Intergenic
906713222 1:47948184-47948206 CAGTGGGGATAGAGAGACTTGGG + Intronic
906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG + Intronic
909071177 1:70995280-70995302 CAGTGTTGCCAGAAAAAAATTGG + Intronic
910359979 1:86406051-86406073 CTGTGTGGTCATAGAGAAATTGG + Intergenic
910697917 1:90041291-90041313 CAGTGTCGTCAGATAGACTTGGG - Intergenic
910863851 1:91769411-91769433 GTGTGTGCCCAGAGAGAAGTTGG - Intronic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
912229279 1:107773738-107773760 CAATCTGGCCAGAGAACATTAGG + Intronic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
913453805 1:119010519-119010541 CTGCTTGGCCAGAGAGAATCAGG + Intergenic
914897306 1:151688202-151688224 CAGGGTGGTCAGAGAGACTCAGG + Intronic
916503465 1:165406972-165406994 GAGAGTGGCCAGAGAGAATGGGG - Intronic
917514512 1:175696380-175696402 CAGGGTGGGCAGAGAGAAAATGG + Intronic
918610744 1:186487996-186488018 CAGTGGGGCCACAGAGAAAGAGG + Intergenic
919962945 1:202490639-202490661 CAGCGTTGCCAGAGGGAAATGGG - Intronic
919971128 1:202579890-202579912 TAGTATGACCAGTGAGAATTTGG + Intronic
920511443 1:206555339-206555361 CAGTGTGGCCACAGAGAATCTGG + Intronic
920552063 1:206870402-206870424 CAGATTGGTCAGAGAGAATCAGG - Intergenic
922904668 1:229164903-229164925 GACTGGGGCCAGAGAGAATAGGG + Intergenic
923391592 1:233518039-233518061 CAGTGTGGCAAGATAAATTTAGG - Intergenic
923602704 1:235417685-235417707 CCGTGTGGCCTGAGAAAGTTTGG + Intronic
924074938 1:240323940-240323962 CAGTGAGGCTTGAGAGAACTTGG - Intronic
1062910062 10:1206406-1206428 CTGTGTGGTCTGAGAGAACTGGG + Intronic
1063949449 10:11208528-11208550 CAGAGAGGCCAGGGAGAATGCGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065840761 10:29699002-29699024 CAGTGTGCTCAGAGACAAATTGG + Intronic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1069643770 10:69975754-69975776 CATTGTTGCCAGTGAGAATGTGG - Intergenic
1069867578 10:71513224-71513246 CAGTGTGGCCAGTGGGGATGTGG + Intronic
1071363461 10:84875317-84875339 CAGTGGGGCCAGAAAGCAGTGGG - Intergenic
1073061241 10:100735148-100735170 CTGTGTGGCCTGAGAAAGTTAGG + Intergenic
1073442348 10:103559521-103559543 CAGTGAGGCCAGGCAGTATTTGG + Intronic
1074232168 10:111548551-111548573 CAGAGAGGCCAGAGAGAAAAGGG - Intergenic
1075012756 10:118888741-118888763 CCCTGTGGCCAGGGAGAGTTTGG - Intergenic
1075701102 10:124469972-124469994 CAGTGTGGCCTCAGAGGTTTGGG - Intronic
1075738475 10:124678831-124678853 CGGTGTGGCCAGATAGACTGTGG - Intronic
1077960950 11:7076522-7076544 CTGAGTGGCCAGAGAGGATCAGG - Intergenic
1079516011 11:21269899-21269921 CAGTGATGGGAGAGAGAATTAGG + Intronic
1079686031 11:23360937-23360959 CCGTGTGGCCAGTGAGAAGTAGG - Intergenic
1083498048 11:63076304-63076326 CACTGTGGTCTGAGAGAGTTTGG + Intergenic
1086616551 11:88828127-88828149 CACTGTGGCTAAAGTGAATTGGG + Intronic
1089919948 11:122199426-122199448 CAGTGGGGACAGATAGCATTAGG + Intergenic
1091315886 11:134613802-134613824 CTGTGGGGCCAGAGAGCACTGGG + Intergenic
1093595833 12:20958127-20958149 CACTGTGGTCTGAGAGAATTTGG - Intergenic
1096073520 12:48788754-48788776 CAGTGTTGCCCGAGGGAGTTGGG - Intronic
1096795970 12:54077776-54077798 CTCTGTGCCCAGAGGGAATTAGG + Intergenic
1096872320 12:54601099-54601121 GAGACTGGGCAGAGAGAATTGGG + Intergenic
1097055664 12:56247757-56247779 CAGTGTGGCCAGAGGCAGCTAGG + Exonic
1097188744 12:57209556-57209578 CGGTGTGGGGAGAGAGAATTTGG + Intronic
1097904875 12:64909437-64909459 CAGTGGTGCCAGAAAGACTTGGG - Intergenic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1098024810 12:66190074-66190096 GAGTGTAGCCAGAGATAATTCGG + Intronic
1099550778 12:84041118-84041140 CACTGTGGTCTGAGACAATTGGG + Intergenic
1099631776 12:85157749-85157771 CAGAGTGCTCAGAGAGAATGGGG + Intronic
1099996171 12:89781425-89781447 CAGTGTTGTCAGTCAGAATTGGG + Intergenic
1100497405 12:95138633-95138655 CAGTGTGGTGGGAGAGAAATGGG - Intronic
1101612647 12:106305055-106305077 CAGTTTGGCTGGAGAAAATTTGG - Intronic
1101859556 12:108471933-108471955 GAGTGAGGCCAGAGAGACCTGGG - Intergenic
1102256649 12:111418984-111419006 CAGAGTGTCCAGAGGGAACTAGG + Intronic
1102356504 12:112241294-112241316 CAGGGTGCCCAGAAAGAAATAGG - Intronic
1102576904 12:113861357-113861379 CAGTGTGGGCAGAAGGAACTGGG - Intronic
1103844292 12:123890726-123890748 CACTGGGGACAGAGAGAAGTGGG + Intronic
1105883125 13:24620974-24620996 CAGTGTTTCCAGAGGGGATTAGG + Intergenic
1106327932 13:28711991-28712013 CAGTGTGACCAAATAGAATTGGG - Intronic
1106543681 13:30712941-30712963 CAGCATGGCCAGAGAGAAGTTGG - Intergenic
1107375653 13:39801353-39801375 CAATGCAGCCAGAGATAATTAGG + Intergenic
1107382005 13:39866761-39866783 GAGAATGGACAGAGAGAATTCGG - Intergenic
1108782835 13:53857650-53857672 CAGTGTGGCTAGAGCAGATTGGG + Intergenic
1109289217 13:60453462-60453484 AAGTGTTGCTAGAGAAAATTAGG - Intronic
1109702988 13:66050728-66050750 CAGTGTGGCTAAAGAGCAATAGG + Intergenic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1112381306 13:98893174-98893196 CAGTGTAACCAGAGCGAAATCGG + Intronic
1112494240 13:99893225-99893247 CAGTGTGGCTAGAGGCCATTCGG - Exonic
1115412981 14:33096480-33096502 CAATGTGTTTAGAGAGAATTGGG + Intronic
1116164700 14:41320026-41320048 AAGTATGGCAAGAGAGAAATGGG + Intergenic
1117000507 14:51366349-51366371 CAGTGAGGCCTGAGACAAATGGG + Intergenic
1118249107 14:64141623-64141645 CAGTGGTGCCAGAGAAAAATAGG - Intronic
1118675792 14:68183397-68183419 CAGTGTGGCTAGAAAGAAGCAGG - Intronic
1119001323 14:70884583-70884605 CAGTGAGGCCAGATAGTAATAGG + Intergenic
1120734370 14:88036788-88036810 CATTGTGACAAAAGAGAATTTGG + Intergenic
1120820787 14:88910189-88910211 TAGTGTGGACAGAGAAAACTTGG - Intergenic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1125076785 15:35628706-35628728 CATTGTAGCCAGATAGATTTAGG + Intergenic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127721060 15:61699796-61699818 AACTGTGGCCAGAAAGAAATGGG + Intergenic
1128112057 15:65082660-65082682 CAATGAGGCCAGAGAGGAGTGGG - Intergenic
1128173155 15:65530622-65530644 CAGTGTGGCCATGGAGAATCAGG + Exonic
1129638882 15:77353354-77353376 CAACGTTGCCAGACAGAATTTGG + Intronic
1130220826 15:82018141-82018163 CTGTGTGTCCAGGGAGAAGTGGG + Intergenic
1132147161 15:99435858-99435880 CAGCGTGCCCAGAGATACTTGGG + Intergenic
1135728563 16:24875883-24875905 AAGCGTGGACAGAGGGAATTGGG + Intronic
1143517052 17:7425095-7425117 GAGTCTGGCCAGGAAGAATTGGG + Intergenic
1144391877 17:14801062-14801084 CAGTGTTCCAAGAGAGAATGTGG - Intergenic
1144940216 17:18933575-18933597 CTCTGTGGCCAGAGATAATGGGG + Intergenic
1146696370 17:34911679-34911701 CAGTGTGGCTGGAGAGAGTTGGG + Intergenic
1147844114 17:43392952-43392974 CTGAGAGGCCAGAGGGAATTCGG - Intergenic
1148173709 17:45546453-45546475 CAATGTGGCTACAAAGAATTAGG - Intergenic
1148275560 17:46298995-46299017 CAATGTGGCTACAAAGAATTAGG + Intronic
1148297668 17:46516563-46516585 CAATGTGGCTACAAAGAATTAGG + Intronic
1149689055 17:58558465-58558487 TAGTGGGGCTAGAGAGAATTTGG - Intronic
1150404918 17:64893377-64893399 CAATGTGGCTACAAAGAATTAGG - Intronic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1151073170 17:71240684-71240706 CAGGGTGGGCAGAGAGGATGGGG + Intergenic
1151413169 17:73944430-73944452 CAGTGTGGCCTCAGAGAGCTTGG - Intergenic
1151911419 17:77086005-77086027 CACTGCTGCCAGAGAGAATGTGG - Intergenic
1152330495 17:79669912-79669934 CAGGGTGACCAGAGAAACTTGGG + Intergenic
1154225919 18:12503992-12504014 CACTGGGGTCAGAGAGAATGAGG + Intronic
1154484787 18:14865063-14865085 AAGTGTGGCCAGAGGGAGTGGGG - Intergenic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155340620 18:24810915-24810937 CAGTGGAGCAAGAGAGCATTTGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155894116 18:31301915-31301937 AAGGGTTGCCAGAGACAATTTGG - Intergenic
1157503754 18:48210652-48210674 GAGTGAGGGAAGAGAGAATTGGG + Intronic
1164414945 19:28039247-28039269 CAGTGTGACCAGAGACCATCAGG + Intergenic
1164519521 19:28967984-28968006 TAGTGTGGGCAGAGACCATTAGG + Intergenic
1164871154 19:31644651-31644673 CAGTGTTTCCACAGAGAACTTGG - Intergenic
1165182785 19:33987197-33987219 CAGAGTGGCAATAGAGGATTAGG + Intergenic
924974798 2:162725-162747 CAGAGTGGCCAGAGTGACATAGG - Intergenic
925432543 2:3807698-3807720 CAGAGGGGCCCAAGAGAATTTGG - Intronic
925922806 2:8648449-8648471 CAATTTCACCAGAGAGAATTTGG - Intergenic
928055550 2:28050496-28050518 CAGAGTGGCCAGAATGAGTTTGG + Intronic
929087711 2:38184605-38184627 CAGTGTGCCCAGAGAGAGAGTGG + Intergenic
929151443 2:38752089-38752111 CATTTTGGCCAGTGACAATTTGG + Intronic
929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG + Intergenic
929862454 2:45691311-45691333 CAGTGTCTCCAGAGAGACTGTGG + Intronic
929964402 2:46522874-46522896 CAGTGAGGCCGTAGAGAAATAGG - Intronic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
932291406 2:70583149-70583171 CAGTGGAGGCAGGGAGAATTCGG - Intergenic
932565037 2:72900858-72900880 CAGTGTGTCCAGGGAGCCTTTGG - Intergenic
932730174 2:74214652-74214674 AAGTGTTGCTAGAGAAAATTAGG + Exonic
932882684 2:75518484-75518506 CAGTGGGGCCACAAAGATTTGGG + Intronic
933000594 2:76917614-76917636 CAGTATGGGAAGAGTGAATTTGG - Intronic
935702913 2:105828235-105828257 GAGAGGGGCCAGGGAGAATTGGG + Intronic
937941836 2:127292286-127292308 CATTGTAGCCAGGGAGAATTTGG - Intronic
938151527 2:128889380-128889402 CAGTGTTGTCATAGAGAAATTGG - Intergenic
938161955 2:128994092-128994114 CAGTGTGGCTGGACATAATTTGG + Intergenic
938409426 2:131051715-131051737 TAGTGTGGCCAGTGAAATTTGGG - Exonic
939453873 2:142408161-142408183 CAGTGTTGCCAGAAAGAATTGGG - Intergenic
940699691 2:157025036-157025058 CATGTTGGCCAGAAAGAATTGGG - Intergenic
941970697 2:171347832-171347854 GAATATGGCCAGAGAGTATTAGG - Intronic
942192971 2:173489125-173489147 CAGTGTGGCCATAATGAAATTGG + Intergenic
942429906 2:175899506-175899528 CAGTGAGGCCAAAGAGAGATGGG - Intergenic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
946398417 2:219455272-219455294 CACTGTGTCCAGAGAGCAATTGG - Intronic
947277426 2:228408496-228408518 CAGTGTATCCAGAGTAAATTAGG + Intergenic
947478204 2:230471279-230471301 AAGTGTGGCCAGATAGAGTAGGG + Intronic
947789410 2:232855346-232855368 CAGTGTGCCCAGCCAGCATTAGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948735899 2:240004650-240004672 CAGTGTGGCCAGAAAAAGTGTGG - Intronic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
1169242552 20:3996833-3996855 CAGAGTGGTAAGAGAGAACTAGG + Intronic
1170196532 20:13694643-13694665 CAGTGTGACTAGAGGGACTTGGG - Intergenic
1170251674 20:14290362-14290384 AAGGGAGGACAGAGAGAATTGGG + Intronic
1170358334 20:15517287-15517309 CAGTGTGAGCAGAGAGCTTTAGG - Intronic
1171050056 20:21849455-21849477 CTGTGTGGCTAGAGTGGATTGGG + Intergenic
1172950952 20:38723344-38723366 CAGTGTGGCCTCTGAGAATGAGG - Intergenic
1174777728 20:53361108-53361130 CAGTGTTGACAGAGAGGATGGGG - Intronic
1175934261 20:62507844-62507866 CGGTGTGGCCAGAGGGCCTTCGG + Intergenic
1176796538 21:13374412-13374434 AAGTGTGGCCAGAGGGAGTGGGG + Intergenic
1177002653 21:15633703-15633725 CAATGTTGGCAGAGAGACTTGGG - Intergenic
1178909669 21:36664366-36664388 CTGTGAGGCCAGAGAGAAAGTGG + Intergenic
1181920155 22:26314408-26314430 CAGTGTGGCCAGCAAGAAGGGGG + Intronic
1182693186 22:32177629-32177651 AAGTTAGGGCAGAGAGAATTTGG - Intergenic
1183304903 22:37077388-37077410 CACTGTGGCCAGATAGACTTAGG - Intronic
1183594988 22:38806061-38806083 CAGTGTGGTTATAGAAAATTTGG - Intergenic
1183661307 22:39223134-39223156 CACTCTGGCCAGAGAGGATGAGG - Intergenic
1184290994 22:43498168-43498190 CAGGGTGGTCAGAGGGAATGCGG - Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184669324 22:46004511-46004533 CAGGGTGGCCAGAGACCCTTTGG - Intergenic
951628014 3:24687941-24687963 CATTTTGCCCAGAGAGAATTTGG + Intergenic
952067666 3:29591579-29591601 CAATGAGGCCACAGAGAATAAGG - Intronic
954618509 3:51982942-51982964 CAGTGTGGGCAGACAGACATTGG + Intronic
955331506 3:58051080-58051102 CAGTGGGGTCAGAGAGACTCAGG - Intronic
955417782 3:58708779-58708801 TAATGTGGCAAGAGAGAATCTGG - Intergenic
956807515 3:72830883-72830905 AACTATGGCCTGAGAGAATTAGG - Intronic
957333824 3:78800439-78800461 CAGTGAGGGCAGGGAGATTTGGG - Intronic
961852032 3:129830118-129830140 CAGTGGAGCCACAAAGAATTTGG - Intronic
962288380 3:134107412-134107434 CAGTGTTGCCAGAGAAAAGGAGG - Intronic
963380421 3:144523095-144523117 AAGTGTAGCCAATGAGAATTAGG + Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
965969724 3:174539946-174539968 CATTTTGCCAAGAGAGAATTAGG + Intronic
966978887 3:185111686-185111708 CAGTGTGGCCAGAGATCCTGGGG - Intronic
967943704 3:194786035-194786057 CAGTGTGGCCCCAGGAAATTTGG + Intergenic
968122774 3:196137454-196137476 CAATGTAGCCATAAAGAATTTGG - Intergenic
968356010 3:198108032-198108054 CAGTTTGGCCAGAAAGTGTTAGG - Intergenic
969034938 4:4245449-4245471 AACTGTGGCCAGTGGGAATTGGG - Intronic
969281942 4:6176703-6176725 CTGTGTGGCCAGCAAGAAATTGG + Intronic
969538739 4:7772741-7772763 CAGTGCACCCAGAGAGAATGTGG - Intronic
969672443 4:8597288-8597310 CAGTGTGGCTAAAGACAACTGGG - Intronic
971077289 4:23164711-23164733 CTGTATGGCCTGGGAGAATTTGG - Intergenic
973563974 4:52165319-52165341 AAGTGTGGACAGATAGCATTAGG - Intergenic
973655853 4:53047156-53047178 CACTGTGCTCAGTGAGAATTGGG - Intronic
973680199 4:53309474-53309496 AAGTGTGACCACAGAGGATTAGG + Intronic
975207945 4:71665751-71665773 CAGAGTGGTCAGAGAGTGTTAGG - Intergenic
977755430 4:100666105-100666127 CATTGAAGCCAGACAGAATTAGG - Intronic
979743297 4:124178606-124178628 CAGTGAGGCCAGGCAGATTTAGG - Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
982932482 4:161426811-161426833 AAGTGTGGCTAGAGACCATTAGG - Intronic
984398489 4:179230268-179230290 AAAGCTGGCCAGAGAGAATTTGG + Intergenic
986475688 5:8129315-8129337 CTGGATGGCCAGAAAGAATTGGG - Intergenic
986620525 5:9668277-9668299 CAGGGATGCCAGTGAGAATTAGG - Intronic
988078802 5:26389032-26389054 CTGTGTGCCAAGAAAGAATTAGG - Intergenic
988137170 5:27188827-27188849 CAGTGGGGCAAGAGAGATGTGGG + Intergenic
989732295 5:44663553-44663575 CAGTATGGGCAGAGAGAAAAAGG + Intergenic
989952564 5:50316945-50316967 CAGTTTGGCCAGATGGAATCAGG - Intergenic
990700322 5:58467928-58467950 CTGTTTGGCCAGAGTGCATTTGG - Intergenic
990929948 5:61077492-61077514 AAGTATAGCAAGAGAGAATTTGG + Intronic
991138390 5:63210217-63210239 CTGTGGGTCCAGAGAAAATTGGG - Intergenic
991524036 5:67536246-67536268 CGTTGTGGCCAGGTAGAATTTGG - Intergenic
991595814 5:68304223-68304245 CAGTGTGGAGAGAGTGTATTTGG + Intergenic
993980700 5:94540124-94540146 CAGTTTGCCCAGAGAGAAAAAGG - Intronic
995417140 5:111924395-111924417 CAGTCTGGCCAGAGAGATCTTGG + Intronic
996307244 5:122061519-122061541 CATTGTGGGCAGAGAAAAATGGG - Intronic
1000761448 5:165230251-165230273 CAGTGTGGCAGCAAAGAATTAGG - Intergenic
1001006296 5:168053392-168053414 AAGTGTGGCCAGTGAGGATATGG - Intronic
1001037132 5:168305295-168305317 CAGAGTGGCCAGCAAGGATTTGG - Intronic
1001260809 5:170227010-170227032 CATGGTGGCCAGGGAGAATGTGG - Intergenic
1003957011 6:11173480-11173502 CAGGCAGGCCAGAGAAAATTAGG + Intergenic
1005088094 6:22027514-22027536 CAGTGTGGGGAGAGAGAATAGGG + Intergenic
1005849573 6:29811551-29811573 CAGTGGTGGCAGAGAGAGTTAGG - Intergenic
1006055108 6:31378412-31378434 CATCGGGGCTAGAGAGAATTTGG + Intergenic
1008242432 6:49129042-49129064 TGGTGTGGCAAGAGAGAATAAGG - Intergenic
1009690873 6:67030962-67030984 CAGTGTGGCCAGAGCGGACGAGG - Intergenic
1010411916 6:75570337-75570359 AAGCGTAGCCAGAGAGAAATGGG + Intergenic
1011294407 6:85810729-85810751 CAGTGGGGCCAGCATGAATTTGG - Intergenic
1011518444 6:88178062-88178084 CAGTGTGGCCACAGATCATTTGG + Intergenic
1012997035 6:105984479-105984501 CAGTGTAGCCAGACAGGAGTGGG + Intergenic
1013786744 6:113789733-113789755 CAGTGAGGCCAGGGAGCAGTGGG - Intergenic
1014085917 6:117343801-117343823 CTGAGTGTCCAGAAAGAATTGGG - Intronic
1015395916 6:132734424-132734446 CAGTTTGGTCAAAGAGTATTTGG - Intronic
1016041083 6:139432436-139432458 TAGTGGGGCCAGAGAGGATTAGG - Intergenic
1016074272 6:139777562-139777584 CAGTATCACCAGAGGGAATTGGG + Intergenic
1017295738 6:152791556-152791578 CAGTGAGGCCAGCGAGCATCTGG - Intergenic
1017380860 6:153827592-153827614 CAGTGAGGCAAGAGAGAACAAGG - Intergenic
1017847613 6:158273134-158273156 CAGTGTTGCCAGTGAAAGTTAGG + Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018093334 6:160363643-160363665 GAGTGTGGCCTGGGAGGATTAGG - Intronic
1018414375 6:163588717-163588739 CAGTGTGACCGTAGAGAATAAGG - Intergenic
1019362628 7:613077-613099 CAGTGTTGCCAGTGAAAATAGGG + Intronic
1019982252 7:4630177-4630199 CAGTGTGGACAAAGAGACTGAGG - Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1021890380 7:25180668-25180690 CAGTGTGGCCAGATAGAGGGTGG + Intergenic
1022663193 7:32385733-32385755 CAGGGGAACCAGAGAGAATTTGG + Intergenic
1023195709 7:37636482-37636504 CAGTGGGGACAGAGAGCATCAGG - Intergenic
1023534463 7:41193767-41193789 CTGTGATGCCAGAGAGACTTGGG - Intergenic
1024673401 7:51616880-51616902 CAGAGTGACCAGAGAGAACTGGG + Intergenic
1024945640 7:54805174-54805196 CAGTGATTCCAGAGAGAATGCGG + Intergenic
1028473866 7:91232850-91232872 CAGGCTGGCCAGTGGGAATTTGG + Intergenic
1030891351 7:115003054-115003076 CTGTTTGGCCAGAGAAATTTTGG - Intronic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1032541392 7:132705886-132705908 CAGTGTGTCCAGAGGGCCTTGGG - Intronic
1035216486 7:157371468-157371490 CACTGTGGCCAAGGAGACTTGGG + Intronic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1036975029 8:13401264-13401286 CAGAGAGGCCACAGAGAAATGGG - Intronic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1038609757 8:29049496-29049518 CAGTGGGGCCAGAGTGAGTGGGG - Intronic
1038919190 8:32063947-32063969 AAGTGTGGGCAGGGAGAATGTGG + Intronic
1039223895 8:35366312-35366334 CCATGTGGCAAGAGAGAAATGGG - Intronic
1039808942 8:41027646-41027668 CAGTGGGGGCAGAGGGAATCTGG - Intergenic
1040410081 8:47145107-47145129 CAGAGTGGGCAGGGAGGATTCGG + Intergenic
1041298374 8:56385957-56385979 CAGGGTGGCTAGAGAAAATGAGG + Intergenic
1042306364 8:67337486-67337508 CACTGTGGCCAGAGACCATGGGG - Intronic
1042878809 8:73465203-73465225 CAGTGTGGCCAAATAGCACTGGG + Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043528879 8:81128080-81128102 CAGTGTTTCCAAAGAGCATTAGG + Intergenic
1044515266 8:93130287-93130309 CAGTGTGTTCAGAGTGAAGTTGG - Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1047995844 8:130335005-130335027 CAGTGTGGCCAGAGAGAATTTGG - Intronic
1048184208 8:132224482-132224504 TAGGGTGACCAGTGAGAATTAGG - Intronic
1048375122 8:133816565-133816587 CAGTGGAACCAGAGGGAATTTGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1051361273 9:16283663-16283685 GAGTGTGGCAAGAGGGAATCAGG - Intergenic
1057870144 9:98710600-98710622 AAGTTAGGGCAGAGAGAATTTGG - Intergenic
1057999300 9:99848864-99848886 CAGTCTGACCAGAAAGAATGAGG - Intronic
1058058923 9:100474665-100474687 AAGTGTGGAAAGAGAGAATTGGG + Intronic
1059011310 9:110464623-110464645 CTGTGTAGCCTGAGAGAAGTAGG + Intronic
1188514669 X:30972434-30972456 TACTGTGGCCGGAGAGAATAAGG + Intronic
1188718386 X:33491052-33491074 AAATATGGACAGAGAGAATTAGG - Intergenic
1190597048 X:52061064-52061086 CAGTGAGGGCAGAGACAGTTTGG - Intergenic
1190611776 X:52193009-52193031 CAGTGAGGGCAGAGACAGTTTGG + Intergenic
1196652687 X:118184686-118184708 CGGTGTGGCCACAGAGAAAAGGG + Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198816800 X:140600039-140600061 TGGAGTGGCCAGAGAGAATGTGG - Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic
1201420242 Y:13790357-13790379 AAGTGTGGCCAGAGAGACTCAGG - Intergenic
1202162292 Y:21948037-21948059 AAGTGTGGCCAAAGAGAAGCAGG + Intergenic
1202229064 Y:22638336-22638358 AAGTGTGGCCAAAGAGAAGCAGG - Intergenic
1202314090 Y:23557829-23557851 AAGTGTGGCCAAAGAGAAGCAGG + Intergenic
1202556712 Y:26112766-26112788 AAGTGTGGCCAAAGAGAAGCAGG - Intergenic