ID: 1047998521

View in Genome Browser
Species Human (GRCh38)
Location 8:130358405-130358427
Sequence CGGCATGAGCAGAGGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 472}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047998521_1047998533 3 Left 1047998521 8:130358405-130358427 CCCGCCTCCCTCTGCTCATGCCG 0: 1
1: 0
2: 2
3: 35
4: 472
Right 1047998533 8:130358431-130358453 GCGGCAGCTCCTCAGCGGCGGGG No data
1047998521_1047998532 2 Left 1047998521 8:130358405-130358427 CCCGCCTCCCTCTGCTCATGCCG 0: 1
1: 0
2: 2
3: 35
4: 472
Right 1047998532 8:130358430-130358452 GGCGGCAGCTCCTCAGCGGCGGG No data
1047998521_1047998536 8 Left 1047998521 8:130358405-130358427 CCCGCCTCCCTCTGCTCATGCCG 0: 1
1: 0
2: 2
3: 35
4: 472
Right 1047998536 8:130358436-130358458 AGCTCCTCAGCGGCGGGGGAGGG No data
1047998521_1047998539 15 Left 1047998521 8:130358405-130358427 CCCGCCTCCCTCTGCTCATGCCG 0: 1
1: 0
2: 2
3: 35
4: 472
Right 1047998539 8:130358443-130358465 CAGCGGCGGGGGAGGGGACGCGG No data
1047998521_1047998540 25 Left 1047998521 8:130358405-130358427 CCCGCCTCCCTCTGCTCATGCCG 0: 1
1: 0
2: 2
3: 35
4: 472
Right 1047998540 8:130358453-130358475 GGAGGGGACGCGGCTGCGCGCGG No data
1047998521_1047998534 4 Left 1047998521 8:130358405-130358427 CCCGCCTCCCTCTGCTCATGCCG 0: 1
1: 0
2: 2
3: 35
4: 472
Right 1047998534 8:130358432-130358454 CGGCAGCTCCTCAGCGGCGGGGG No data
1047998521_1047998531 1 Left 1047998521 8:130358405-130358427 CCCGCCTCCCTCTGCTCATGCCG 0: 1
1: 0
2: 2
3: 35
4: 472
Right 1047998531 8:130358429-130358451 CGGCGGCAGCTCCTCAGCGGCGG No data
1047998521_1047998537 9 Left 1047998521 8:130358405-130358427 CCCGCCTCCCTCTGCTCATGCCG 0: 1
1: 0
2: 2
3: 35
4: 472
Right 1047998537 8:130358437-130358459 GCTCCTCAGCGGCGGGGGAGGGG No data
1047998521_1047998541 26 Left 1047998521 8:130358405-130358427 CCCGCCTCCCTCTGCTCATGCCG 0: 1
1: 0
2: 2
3: 35
4: 472
Right 1047998541 8:130358454-130358476 GAGGGGACGCGGCTGCGCGCGGG No data
1047998521_1047998542 27 Left 1047998521 8:130358405-130358427 CCCGCCTCCCTCTGCTCATGCCG 0: 1
1: 0
2: 2
3: 35
4: 472
Right 1047998542 8:130358455-130358477 AGGGGACGCGGCTGCGCGCGGGG No data
1047998521_1047998535 7 Left 1047998521 8:130358405-130358427 CCCGCCTCCCTCTGCTCATGCCG 0: 1
1: 0
2: 2
3: 35
4: 472
Right 1047998535 8:130358435-130358457 CAGCTCCTCAGCGGCGGGGGAGG No data
1047998521_1047998530 -2 Left 1047998521 8:130358405-130358427 CCCGCCTCCCTCTGCTCATGCCG 0: 1
1: 0
2: 2
3: 35
4: 472
Right 1047998530 8:130358426-130358448 CGGCGGCGGCAGCTCCTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047998521 Original CRISPR CGGCATGAGCAGAGGGAGGC GGG (reversed) Intronic
900031141 1:373914-373936 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051708 1:602163-602185 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900310989 1:2033028-2033050 GGGCAGGAGCAGATGAAGGCGGG + Intergenic
900320875 1:2082996-2083018 GGACATGAGGAGAGGGAGGACGG - Intronic
900341122 1:2189854-2189876 CGGCAGGAGCAGAGAGGGCCCGG - Intronic
900582950 1:3418357-3418379 CTGCACCAGCAGAGGGTGGCCGG - Intronic
900932829 1:5747619-5747641 AGGGAGGAGCAGAGGGAGGGAGG + Intergenic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901629774 1:10642481-10642503 GGGCAGGAGGAGAGAGAGGCGGG + Intronic
901934080 1:12616274-12616296 AGCCATCAGGAGAGGGAGGCAGG - Intronic
902302277 1:15510682-15510704 CGGCATGAGCAAAGGCAGGGAGG + Intronic
902689938 1:18104805-18104827 CACCATGAACAGAGGGAGGCTGG + Intergenic
903437214 1:23359600-23359622 CGGGATGTGCAGAGGCAGCCAGG + Exonic
903769722 1:25756345-25756367 TGGCCTGGGCAGAGGCAGGCAGG - Intronic
903811256 1:26036164-26036186 CCGCATGTCCAGAGGGCGGCCGG + Exonic
903925054 1:26826305-26826327 AGGCATTTGCAGAGGCAGGCAGG - Intergenic
905316710 1:37086563-37086585 GGGCCTGAACAGACGGAGGCAGG - Intergenic
907486879 1:54784177-54784199 AGGCATGAGCAGAGGGAGGTGGG + Intronic
908261858 1:62345270-62345292 CGTTAAGAGCAGATGGAGGCTGG + Intergenic
911618334 1:100038543-100038565 CGGCCAGAGCAGAGGGCGGCAGG - Intronic
912853451 1:113146869-113146891 AGCCATGGGCAGAGGGAGGGAGG - Intergenic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916056655 1:161073048-161073070 AGGCATGGGGAGAGGGAGACGGG + Intronic
916599316 1:166276646-166276668 AGGCATGAGCAGAGGTGGGCGGG - Intergenic
916943701 1:169702602-169702624 GTGGATGAGCAGAGAGAGGCAGG - Intronic
917674208 1:177303952-177303974 TGGCAAGACCAGGGGGAGGCAGG - Intergenic
919103538 1:193122128-193122150 CGACAAGAGAAGAAGGAGGCAGG + Exonic
919859787 1:201731919-201731941 CAGCATGAGCACAGGGCAGCTGG - Intronic
920109242 1:203575474-203575496 TGGCATGGGCAGAGTGAGGGTGG - Intergenic
920305413 1:205015311-205015333 CAGGATGAGCAGTGGGAGTCTGG - Intronic
920346378 1:205308330-205308352 GGGCTTGAGCACAGGTAGGCTGG + Intronic
920659973 1:207907420-207907442 CTGGATGAGCAAAGGTAGGCAGG - Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
922801614 1:228367200-228367222 CGGCTTGAGGAGGGGCAGGCAGG + Intronic
923042970 1:230332974-230332996 CAGCATGGACAGTGGGAGGCCGG + Exonic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
924715176 1:246566494-246566516 AGGGGTGCGCAGAGGGAGGCGGG + Exonic
924876870 1:248115677-248115699 TGGCATCAGGAGACGGAGGCTGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063811961 10:9721858-9721880 AGACATCAGCAGAGGGAGCCAGG + Intergenic
1064018912 10:11793904-11793926 CAGGATGAGAAGAGGAAGGCAGG + Intergenic
1066617300 10:37308229-37308251 GGGCAAAAGCAGAGGGAGGGAGG - Intronic
1067084165 10:43229435-43229457 GGGCAGGAGCAGAGGCAGGCTGG + Intronic
1067352579 10:45489980-45490002 GGGCATGAGAGGAAGGAGGCTGG - Intronic
1067372602 10:45699340-45699362 TGGCATGAGGAGAGGGGGGCGGG - Intergenic
1067387176 10:45826784-45826806 TGGCATGAGGAGAGGGGGGCGGG + Exonic
1067418952 10:46130467-46130489 TGGCATGAGGAGAGGGGGGCGGG - Intergenic
1067447100 10:46357823-46357845 TGGCATGAGGAGAAGGGGGCAGG - Intergenic
1067590282 10:47502937-47502959 TGGCATGAGGAGAGGGGGGCGGG + Exonic
1067637403 10:48011039-48011061 TGGCATGAGGAGAGGGGGGTGGG + Intergenic
1067777543 10:49174425-49174447 CGGCAAGAGCCGAGCGATGCTGG - Intronic
1067804564 10:49384059-49384081 CGGGTTGGGCAGAGGCAGGCTGG - Intronic
1067876086 10:50009295-50009317 TAGCATGAGGAGAGGGGGGCGGG - Exonic
1069752214 10:70751971-70751993 GGGCATAGGCAGAGGGAGGTGGG + Intronic
1070134000 10:73675468-73675490 TGGCATGAGGAGAGGGGGGCGGG + Exonic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070393862 10:75994542-75994564 CGGGAGCAGGAGAGGGAGGCTGG + Intronic
1070663561 10:78327911-78327933 AGGCATGAGCAGTGGTGGGCAGG + Intergenic
1070772705 10:79091686-79091708 CGGCATGACCAAAGGAAGGGAGG + Intronic
1070811199 10:79298942-79298964 CTGCATGCTCAGAGGAAGGCAGG - Intronic
1071607710 10:87008966-87008988 TGGCATGAGGGGAGGGGGGCAGG - Intergenic
1073026228 10:100489143-100489165 AGGCATGTGCTGAGGGAGACTGG - Intronic
1073057193 10:100710310-100710332 GGGCAGGAGTGGAGGGAGGCGGG - Intergenic
1073125341 10:101145837-101145859 CGGCCTGGGCACAGTGAGGCTGG - Intergenic
1075031699 10:119028929-119028951 CGGTAAGAGCGGAGGGACGCAGG - Intergenic
1075450939 10:122551625-122551647 CAGCATGAGCAACAGGAGGCAGG - Intergenic
1075662423 10:124207284-124207306 CAGCATGAACAGAGGTTGGCGGG + Intergenic
1075851532 10:125592231-125592253 AGGCATGAGGAAAGCGAGGCTGG + Intronic
1076316517 10:129545628-129545650 TTGCAAAAGCAGAGGGAGGCTGG - Intronic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1077171450 11:1168075-1168097 TGGCATGAACAGCGAGAGGCGGG + Intronic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077365686 11:2160696-2160718 CAGCATGGGCAGAAGGGGGCAGG - Intronic
1077365703 11:2160727-2160749 CGCCAGGAGCAGGGGGTGGCTGG + Intronic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1078507354 11:11962198-11962220 GGCCATGGGCAGAGGGAGGGAGG - Intergenic
1079035037 11:17013893-17013915 CGGCGGGAGCAGAGGAAGGGCGG + Intronic
1080411724 11:32031260-32031282 GGGCATGAGCGGAGGGAGCGTGG - Intronic
1080699530 11:34632684-34632706 GGGCAAGAGCAGAGAGAGCCGGG - Intronic
1080910270 11:36589969-36589991 TGGCATGAGCCCAGAGAGGCAGG - Intronic
1081626439 11:44658804-44658826 AGGGCTGAGCAGAGGGAGGGAGG + Intergenic
1081674186 11:44958753-44958775 GGGGCTGAGCAGGGGGAGGCAGG + Intergenic
1081720548 11:45285681-45285703 GGGTAAGAGGAGAGGGAGGCTGG - Intronic
1083159324 11:60845079-60845101 AGGTCTGAGCAGAGGGAGCCGGG + Intronic
1083222166 11:61259478-61259500 AGCCATGAACGGAGGGAGGCAGG + Intronic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083609930 11:63999832-63999854 CGGCCTGGGCAGAAGGGGGCAGG + Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084421656 11:69063506-69063528 TGGCAAGAGCGGAGGGCGGCAGG - Intronic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1085413090 11:76303086-76303108 AGGCTGGAGTAGAGGGAGGCTGG - Intergenic
1085722189 11:78922246-78922268 CAGCATGAGGAAAGGCAGGCAGG + Intronic
1085929124 11:81059473-81059495 TGGCTGGAGCAGAGGGAGGTAGG - Intergenic
1088122439 11:106385998-106386020 AGGCATGGACAGAGGGAGGAAGG - Intergenic
1088344268 11:108805022-108805044 GGGCATTAGCACAAGGAGGCAGG + Intronic
1089637956 11:119828475-119828497 AGGCATCAGGAGAGGGTGGCTGG + Intergenic
1089685014 11:120141211-120141233 CAGCATGTGCTGAGAGAGGCTGG + Intronic
1089982069 11:122780726-122780748 TGGCAGGAGCACAGGCAGGCAGG + Intronic
1090210957 11:124920971-124920993 GAGCATGCGCAGACGGAGGCGGG - Exonic
1090262426 11:125331141-125331163 CGGCATTGGCAAATGGAGGCTGG - Intronic
1090331039 11:125932482-125932504 CCGCCTGAGCCCAGGGAGGCAGG + Intergenic
1090353634 11:126124240-126124262 AGGTATGAGCAGAGGGAGAGAGG - Intergenic
1090670291 11:128941063-128941085 CGGGATGAGGAGAGCCAGGCTGG + Intronic
1092118623 12:6027517-6027539 GGGTCTGATCAGAGGGAGGCAGG + Intronic
1092129293 12:6097474-6097496 AGACATGGGCAGAGGGAGACGGG + Intronic
1092294614 12:7188668-7188690 GTGCATGAGCGGAGGCAGGCAGG - Intronic
1092486590 12:8907577-8907599 GGGCCTGAGCAGAGGGACTCAGG + Intergenic
1092950648 12:13499989-13500011 AGAGATGAGCAGAGGGAGTCTGG + Intergenic
1092986192 12:13848409-13848431 TGCCAGGAGCAGAGGGAAGCAGG + Intronic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1094038243 12:26093798-26093820 CTGCATGTGCAGAGGTGGGCAGG + Intergenic
1095399184 12:41795021-41795043 TGGCAGGAACAGAGGGTGGCAGG + Intergenic
1096129946 12:49150314-49150336 AGGCATAAGAAGAGGGAGACAGG - Intergenic
1096193517 12:49634605-49634627 AGGCCTGGGCAGAGGGAGCCAGG + Intronic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096482430 12:51951626-51951648 CGGGCGGAGGAGAGGGAGGCGGG + Intergenic
1096752761 12:53772650-53772672 TGGCATCTGGAGAGGGAGGCTGG + Intergenic
1097180125 12:57167052-57167074 AGGGATGGGCAGAGGGAGTCAGG + Intronic
1097891354 12:64780767-64780789 CGGGAGGAGCAGCGGGAGCCGGG + Intergenic
1098281574 12:68867774-68867796 CAGCATGAGCAGTGGCAGCCTGG - Intronic
1098339235 12:69434649-69434671 TGGCTAGAGCAGAGGGAGGGAGG + Intergenic
1102198025 12:111038020-111038042 CAGGATGAGCAAAGAGAGGCCGG + Intronic
1102465338 12:113127780-113127802 GGACATGGGCAGAGGGAGGAGGG - Intronic
1102620948 12:114193957-114193979 GGCCATGAGGTGAGGGAGGCAGG + Intergenic
1102920044 12:116785025-116785047 TGGCAGGGGCAGAGGCAGGCTGG - Intronic
1103361022 12:120353713-120353735 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1103437237 12:120936440-120936462 CGGCACTTGCAGAGGGAGGGAGG - Intergenic
1105284227 13:18991698-18991720 GGGTTTGAGCAGAGGGAGGTGGG - Intergenic
1106026553 13:25960708-25960730 GGGCAAAAGCAGAGGGAGGGAGG - Intronic
1106068247 13:26380045-26380067 CAGCAGGAGCAGTGGGATGCAGG + Intronic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1107015476 13:35705310-35705332 GGGCATGAGTAGAGGGAGGAAGG + Intergenic
1107406360 13:40117736-40117758 CTGCCTGGGGAGAGGGAGGCAGG + Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1107736444 13:43404079-43404101 TGGCAAGAGGGGAGGGAGGCTGG - Intronic
1107966605 13:45603505-45603527 GGGCAGGAGCCAAGGGAGGCAGG - Intronic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1110008079 13:70297242-70297264 CCCCAAGAGCACAGGGAGGCTGG - Intergenic
1112131398 13:96527762-96527784 TGGCTGGAGCAGAGGGAGGCAGG + Intronic
1116487763 14:45471524-45471546 GGACATGAGCAGAGAGAGGTTGG + Intergenic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1117513261 14:56473715-56473737 CGGCCTCAGCACAGGGAGTCAGG - Intergenic
1118716543 14:68564045-68564067 CTGCATGGGCTGGGGGAGGCTGG + Intronic
1118817784 14:69325024-69325046 TGTCAGGAGCTGAGGGAGGCCGG + Intronic
1119028635 14:71174281-71174303 CGGCAAGGGCAGAGCCAGGCTGG - Intergenic
1119199038 14:72739590-72739612 GGGCATGAGCCCAGGGAGGATGG + Intronic
1120791746 14:88590371-88590393 GAGCCAGAGCAGAGGGAGGCAGG - Intronic
1120978951 14:90274209-90274231 CAGCATGGGCAGGGTGAGGCTGG + Exonic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121670856 14:95709789-95709811 GGGCAGGACCAGATGGAGGCAGG + Intergenic
1122890194 14:104728715-104728737 TGGCAAGCGCAGGGGGAGGCCGG - Intronic
1123126733 14:105952338-105952360 GGGCATATGCAGAGAGAGGCTGG - Intergenic
1123145848 14:106129407-106129429 AGGCAGGTGCAGATGGAGGCTGG - Intergenic
1202849536 14_GL000225v1_random:8335-8357 CGGTATGGGCAGAGAGAGGCCGG - Intergenic
1202854589 14_GL000225v1_random:42750-42772 CGGCATGTGCAGAGAGAGGACGG - Intergenic
1202858367 14_GL000225v1_random:64974-64996 GGACATGGGCAGAGAGAGGCCGG + Intergenic
1202921807 14_KI270723v1_random:34615-34637 GGACATGGGCAGAGAGAGGCCGG - Intergenic
1202923109 14_KI270724v1_random:2966-2988 GGACATGGGCAGAGAGAGGCCGG + Intergenic
1123895878 15:24829429-24829451 GGGCATGAGAAGAGGGTGGTGGG + Intronic
1124109357 15:26772608-26772630 CGGCCTGGGCGGAGGGAGGCGGG - Intronic
1124560432 15:30768986-30769008 AGGCCTGAGGAGAGGGAGACCGG + Intronic
1124670779 15:31636455-31636477 AGGCCTGAGGAGAGGGAGACAGG - Intronic
1124878957 15:33623849-33623871 GGGCATAGCCAGAGGGAGGCAGG - Exonic
1125425269 15:39542522-39542544 GGCCATGAGCCGAGGAAGGCAGG - Intergenic
1125929510 15:43590171-43590193 CTGCGCGAGCGGAGGGAGGCGGG - Exonic
1125942677 15:43690003-43690025 CTGCGCGAGCGGAGGGAGGCGGG - Intergenic
1126185864 15:45829852-45829874 CCCCAAGAGCACAGGGAGGCTGG + Intergenic
1126688339 15:51267435-51267457 TGGCTTGAGCACAGGGACGCTGG + Intronic
1127720118 15:61691206-61691228 TGGCATCTGCAGCGGGAGGCAGG - Intergenic
1128331630 15:66760036-66760058 CGGCATGGGCAGAGGCACACGGG - Intronic
1128682601 15:69662599-69662621 GGGCAGGAGCAGAGAGGGGCTGG + Intergenic
1129170578 15:73805061-73805083 CTGCAAGGGGAGAGGGAGGCAGG + Intergenic
1129301825 15:74629897-74629919 CCGCATGAGGAGATGGAGGGCGG + Exonic
1129540765 15:76345890-76345912 CGGCAGGAGCTCAGGAAGGCCGG + Intergenic
1129665294 15:77576226-77576248 AGGGAGGAGCAGGGGGAGGCTGG + Intergenic
1129761190 15:78130275-78130297 TGGCATGGGCAGAGGGAGAGAGG + Intronic
1129845984 15:78767951-78767973 GGGGAGGAGCAGAGGGAGCCGGG - Intronic
1130135234 15:81176696-81176718 AGGCAACAGCAGCGGGAGGCAGG + Intronic
1130599069 15:85264074-85264096 GGGGAGGAGCAGAGGGAGCCGGG - Intergenic
1130910337 15:88266326-88266348 GGGCATGTGCTGAGGGTGGCAGG + Intergenic
1131151195 15:90048421-90048443 TGGCATCAGCACAGGGAGGAGGG + Intronic
1131728371 15:95251981-95252003 TGGCATGAGGAGAGGTAGGAGGG + Intergenic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132551325 16:554979-555001 CGGCAGGAGCAGATGGAGTGAGG + Intergenic
1132864661 16:2087436-2087458 GGGCAGGAGCATAGGGAGGTGGG + Intronic
1133234336 16:4380885-4380907 CGGCAGCAGCAGAGGGACCCTGG - Exonic
1133234925 16:4383265-4383287 CGGAAAGAGCAGAGGGAGAGCGG + Exonic
1133809827 16:9152826-9152848 AGGGGTGAGCAGAGGGAGGTGGG - Intergenic
1134857995 16:17536784-17536806 CTGAATGAGAAGAGGGAGCCAGG + Intergenic
1135024564 16:18989220-18989242 AGGCATCCCCAGAGGGAGGCAGG + Intronic
1135241691 16:20812652-20812674 AGGTATGAGGAGAGGGAAGCAGG - Intronic
1135315504 16:21441338-21441360 AGGCATCCCCAGAGGGAGGCAGG - Intronic
1135368430 16:21873602-21873624 AGGCATCCCCAGAGGGAGGCAGG - Intronic
1135443387 16:22497543-22497565 AGGCATCCCCAGAGGGAGGCAGG + Intronic
1135449184 16:22543010-22543032 AGGCATCCCCAGAGGGAGGCAGG + Intergenic
1136312175 16:29419998-29420020 AGGCATCCCCAGAGGGAGGCAGG - Intergenic
1137753557 16:50884329-50884351 CGGGATGGGCTGGGGGAGGCGGG + Intergenic
1137753566 16:50884348-50884370 CGGGATGGGCTGGGGGAGGCGGG + Intergenic
1137753575 16:50884367-50884389 CGGGATGGGCTGGGGGAGGCGGG + Intergenic
1137753584 16:50884386-50884408 CGGGATGGGCTGGGGGAGGCGGG + Intergenic
1137753593 16:50884405-50884427 CGGGATGGGCTGGGGGAGGCGGG + Intergenic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139660071 16:68414687-68414709 TGGCATGAGATGAGGAAGGCTGG + Intronic
1139886800 16:70214056-70214078 AGGCATCCCCAGAGGGAGGCAGG - Intergenic
1140892620 16:79298181-79298203 CCCCATGGGCAGAGAGAGGCTGG - Intergenic
1140963505 16:79941279-79941301 AGACTTGAGCAGAGGGATGCTGG + Intergenic
1141557923 16:84848210-84848232 AGGCAGGAGCAGAGGGCTGCTGG - Intronic
1142560891 17:808189-808211 CCCCAGGAGCAGAGGGAGGTGGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1143238971 17:5427772-5427794 GGGCAGAGGCAGAGGGAGGCTGG + Intronic
1143453093 17:7048309-7048331 AGGCATGGGCAGAGGTAGCCAGG - Intergenic
1143536482 17:7543375-7543397 TGGAAGGAACAGAGGGAGGCAGG + Intergenic
1143720556 17:8806123-8806145 CTGCATGAGCTGGGGGAGGGTGG + Intronic
1143775743 17:9197772-9197794 GGGCAGGGGAAGAGGGAGGCTGG - Intronic
1144727642 17:17509910-17509932 CGCCATGAGCAGAGGGCGAAGGG - Intronic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1144847766 17:18228930-18228952 CTGGATGGGCAGAGGCAGGCAGG + Intronic
1145294186 17:21575028-21575050 TGCCAGGAACAGAGGGAGGCAGG - Intergenic
1145369648 17:22298158-22298180 TGCCAGGAACAGAGGGAGGCAGG + Intergenic
1147193117 17:38748497-38748519 CGGGAAGAGGAGGGGGAGGCTGG + Intronic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147983177 17:44287873-44287895 AGGCATGAGTAGAGGGAGAGTGG - Intergenic
1148108063 17:45129967-45129989 TGGCAGGGGCAGAGCGAGGCGGG + Intronic
1148759941 17:49994422-49994444 CGGGATGAGCTGAGAGAGGAAGG - Intronic
1149085334 17:52709832-52709854 CGTCAAGAGCACAGGGAGGCTGG - Intergenic
1150341724 17:64373946-64373968 AGGCAACAGCAGAGGGAAGCTGG - Intronic
1150589877 17:66552791-66552813 GGGCATGAGCACCAGGAGGCAGG + Intronic
1151518452 17:74612422-74612444 GGGCATGAGGGCAGGGAGGCAGG + Exonic
1151827609 17:76531847-76531869 CGGCTTGGCCAGAGGGAGGAGGG - Intronic
1152245153 17:79181625-79181647 CGGCAGTGGCAGAGGGTGGCCGG - Intronic
1152929110 17:83100936-83100958 CAGCTTGAGCAGGGGCAGGCTGG + Intergenic
1152948512 17:83211799-83211821 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1153515343 18:5895968-5895990 AGGCACGAGGGGAGGGAGGCAGG - Intergenic
1153543774 18:6185425-6185447 AGACAGGAGGAGAGGGAGGCTGG + Intronic
1154494261 18:14944347-14944369 AGGGAAGAGCAGAGGGAGGGAGG - Intergenic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1155825648 18:30439361-30439383 TGTCTAGAGCAGAGGGAGGCAGG - Intergenic
1156449912 18:37261089-37261111 GGGCATGAGCAGGGAGAGGCTGG - Intronic
1156510024 18:37628481-37628503 GGGCATGAACACTGGGAGGCAGG - Intergenic
1157285408 18:46374038-46374060 CAGCATGAGCAGGGCCAGGCTGG + Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160236957 18:77093311-77093333 CGGCATGAGGAGAGAGCCGCAGG + Intronic
1160984524 19:1832176-1832198 CGCCCTGAGCCGAGGGATGCAGG + Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161370709 19:3909392-3909414 CGGCAGGAGTGGAGGCAGGCAGG + Intronic
1161422021 19:4181171-4181193 TGGCTGGAGCAGAGTGAGGCAGG - Intronic
1161596647 19:5154164-5154186 TGGCTGGAGCAGAGGGAGGCAGG + Intergenic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1163021477 19:14482971-14482993 CGGCATGAGCAGCGAGAAGTGGG + Exonic
1163032933 19:14556149-14556171 TGGCCTGAGCAGAGTGAGTCAGG - Intronic
1163427220 19:17246118-17246140 GGGGAGGGGCAGAGGGAGGCGGG - Intronic
1164011768 19:21209922-21209944 CTGCTTGTGCAGAGTGAGGCTGG + Intergenic
1164061463 19:21679173-21679195 CTACTAGAGCAGAGGGAGGCTGG + Intergenic
1165410145 19:35654831-35654853 AGGCATCAGCAGAAGGAGACAGG - Intronic
1165838848 19:38774831-38774853 AGGCCTGGGCAGAGGCAGGCTGG + Intergenic
1165840607 19:38787309-38787331 AGGCCTGGGCAGAGGCAGGCTGG - Intergenic
1165895037 19:39136368-39136390 TGGCAGGAGAAGAGGGAAGCAGG - Intronic
1166824736 19:45601761-45601783 AGGCAGGGGCAGAGGGAGGTGGG + Intronic
1166840068 19:45691936-45691958 CTGCCTGAGGAGAGAGAGGCGGG + Exonic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167721670 19:51184132-51184154 AGGACTGAGCAGAGGGATGCGGG - Intergenic
1167762656 19:51459065-51459087 AGGCCTGAGCAGAGGGACACGGG + Intergenic
1167988842 19:53340804-53340826 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1168311982 19:55465068-55465090 TGGGCTGAGCAGAGGGAGGGAGG - Intergenic
1168349823 19:55669378-55669400 AGGCTTGAGCAGAGGGAGACTGG + Intronic
924959502 2:21363-21385 CTGCATGGGCGGCGGGAGGCTGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925385246 2:3457659-3457681 CGGCATGAGCAGCGTGACTCAGG + Exonic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
927754516 2:25698053-25698075 ACGCAGGAGGAGAGGGAGGCTGG + Intergenic
927860832 2:26559034-26559056 GGGCATGAGCATAGGTAGGGTGG + Intergenic
928325533 2:30316626-30316648 CACCATGAGCAGAAGTAGGCAGG - Intronic
930142253 2:47964397-47964419 GGCCAGGAGCAGAGGGAGGGAGG + Intergenic
931855523 2:66298722-66298744 CGAGATGAGCAGAGGGCTGCAGG + Intergenic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
934752044 2:96799753-96799775 TGGCTGGGGCAGAGGGAGGCTGG + Intronic
935013450 2:99157154-99157176 CTGCATGTGCAGAGTGTGGCAGG - Intronic
935363961 2:102270259-102270281 AGGCAGGAGCAGAGAGAGGGAGG - Intergenic
936427561 2:112434119-112434141 TGGGATGGGCAGATGGAGGCGGG - Intronic
936537246 2:113321888-113321910 GAGCATGGGCAGAGGGAGGCCGG + Intergenic
936954869 2:118013757-118013779 CTGCATGGGCAGGGGGCGGCGGG - Intronic
937088690 2:119190223-119190245 AGGGATGGGCAGAGGCAGGCTGG + Intergenic
937982784 2:127624924-127624946 AGGCATGGGCAGGGGGTGGCAGG + Intronic
938196683 2:129334799-129334821 GGGCATCAGCAAAGTGAGGCTGG + Intergenic
938259129 2:129882772-129882794 GGGCAGGAACAGAGGGAGGGAGG - Intergenic
939056749 2:137374143-137374165 TGGCATGAGGGGAGGGAGGGAGG + Intronic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
940104303 2:150080785-150080807 GGGCAAGGGCAGAGGAAGGCAGG + Intergenic
942249412 2:174034689-174034711 CGGCTTGGGGAGAGGGATGCTGG - Intergenic
944676187 2:202035257-202035279 GGGCATGAGAAGGGGAAGGCGGG - Exonic
946307581 2:218864996-218865018 GGGCAGGGGCAGAAGGAGGCTGG + Intronic
946954270 2:224911626-224911648 AGGCAGGAGCTGAAGGAGGCTGG + Intronic
948313918 2:237012325-237012347 CTGCATGAGAAGAGGAAGGGAGG + Intergenic
948695151 2:239729521-239729543 CGGGTGGGGCAGAGGGAGGCGGG + Intergenic
948989385 2:241544891-241544913 GGCCATGAGCCGAGGGATGCAGG - Intergenic
948995467 2:241576129-241576151 CGGGAGGAGGAGAGGGAGGAAGG - Intergenic
949064499 2:241981458-241981480 TGGCATGAGAACAGGGATGCTGG - Intergenic
1168793482 20:595899-595921 CTGCAAGGGCAGAGAGAGGCAGG + Intergenic
1169071161 20:2731480-2731502 TGGCATGAGCAGAGGTAAGGTGG - Intronic
1169367149 20:5001170-5001192 CGGCAGGAGCTGAGGGCCGCCGG + Intronic
1169474872 20:5922506-5922528 AGAAATGGGCAGAGGGAGGCGGG + Exonic
1169877952 20:10318161-10318183 CGGCAGGAGTAGAGGGATACTGG - Intergenic
1171376363 20:24696621-24696643 GGGCATGAGCTGAGACAGGCTGG + Intergenic
1172204943 20:33156695-33156717 AGGCAAGAGCGGAGGGAGGTAGG + Intergenic
1172481371 20:35273874-35273896 CTGCTTGAGCCAAGGGAGGCAGG - Intronic
1172585693 20:36082744-36082766 CAGCATGAGCACAGTGAGACAGG - Intergenic
1173545491 20:43894685-43894707 GGGAGTGAGCTGAGGGAGGCTGG - Intergenic
1173546965 20:43905067-43905089 TGGCATGAGCAGAGGTGAGCAGG + Intergenic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1173942076 20:46919952-46919974 AGGCCTGAGCAGAGGGAGAGAGG + Intronic
1175125838 20:56750848-56750870 CGGGGTGAGCAGAGGGACACAGG - Intergenic
1175269874 20:57726133-57726155 AGCCATGAGCACAGGGATGCTGG - Intergenic
1175756508 20:61533575-61533597 CCTCATGGGCAGAGGAAGGCAGG - Intronic
1175846172 20:62060085-62060107 AGACATCAGCACAGGGAGGCCGG - Intronic
1176305307 21:5120127-5120149 CTGCCTGCGCAGAGGGCGGCAGG - Intronic
1176374670 21:6081085-6081107 TGGGATGGGCAGATGGAGGCGGG + Intergenic
1178038912 21:28617283-28617305 GGGCTGGAGTAGAGGGAGGCAGG + Intergenic
1179101812 21:38360982-38361004 GGGCATGAGCCCAGGCAGGCTGG - Intergenic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1179409366 21:41150235-41150257 CTGCGTGAGCACAGGGGGGCTGG + Intergenic
1179637757 21:42724303-42724325 CAGCAATAGCAGAGGCAGGCAGG + Intronic
1179748805 21:43457160-43457182 TGGGATGGGCAGATGGAGGCGGG - Intergenic
1179766794 21:43580047-43580069 AGGCCTGAGCAGAGGGATGTAGG - Intronic
1179780186 21:43694633-43694655 AGGCCTGAGCAGAGCGTGGCTGG - Exonic
1179851748 21:44141904-44141926 CTGCCTGCGCAGAGGGCGGCAGG + Intronic
1180086843 21:45511457-45511479 CGCCATGAGCAGAGGGCCGGGGG - Intronic
1180715758 22:17871166-17871188 CGTGATGGGCAGAGGCAGGCTGG - Intronic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1182110233 22:27717967-27717989 CGGCATGAGATGAGGCTGGCAGG + Intergenic
1182292180 22:29288742-29288764 AGGCATGAGCAGAGGTGGGCGGG + Exonic
1182445367 22:30386773-30386795 GGCCATGAGCAGAGGGAGGTAGG + Intronic
1183091789 22:35527196-35527218 AGGCAGGAGAAGAGGGAGGGGGG + Intergenic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1184189118 22:42883193-42883215 TGGCAGGAGCAGGGTGAGGCTGG - Intronic
1184241439 22:43213024-43213046 AGGCCAGAGCAGAGGGAGGCGGG + Intronic
1184321920 22:43748407-43748429 GGACATGAGGAGAGGGAAGCCGG - Intronic
1184355818 22:43978963-43978985 TGGCAGGGGCAGAGGAAGGCAGG - Intronic
1184812359 22:46844762-46844784 CGGTCTGAGCACAGTGAGGCTGG + Intronic
1185110245 22:48896503-48896525 TGGCAGGAGCAGAGGGGGTCGGG + Intergenic
1185153633 22:49180321-49180343 CCACATGTGCAGAGGGAGCCTGG - Intergenic
950262788 3:11554498-11554520 CAGGATGAGCAGAGGCTGGCTGG + Intronic
950722187 3:14891310-14891332 CAGCAGGTGCAGAGGGCGGCTGG - Intronic
952920114 3:38278182-38278204 GAGCATGAGCAGGAGGAGGCGGG - Exonic
953038758 3:39236577-39236599 TGGCAAGAGCACAGGGTGGCTGG - Intergenic
953480986 3:43251927-43251949 CAGCAGGAGCAGAGAGAGACTGG - Intergenic
953482574 3:43264329-43264351 CGCCATGAGTAGAGGGAGCATGG + Intergenic
954130858 3:48560228-48560250 CAGCATGTGCAGAGACAGGCAGG + Intronic
954682954 3:52355732-52355754 CAGCGTGAGCAGAGGGGGACTGG - Intronic
954692843 3:52404920-52404942 CAGCAGGAGCTTAGGGAGGCAGG - Intronic
954879335 3:53823182-53823204 AGGCATGGGCAGACTGAGGCTGG - Intronic
955514067 3:59709256-59709278 GGGCATTATAAGAGGGAGGCAGG + Intergenic
956681029 3:71780836-71780858 TGGCATGATCATAGGGTGGCAGG - Intronic
956936113 3:74103640-74103662 AGACATTAGCAGAGGGAGCCAGG - Intergenic
960875138 3:122288234-122288256 GGACATGAGCTGAGGAAGGCAGG + Intergenic
964225016 3:154388636-154388658 AGGCAGGAACAGAGGCAGGCAGG + Intronic
966223101 3:177569965-177569987 GGCCATGTGCAGATGGAGGCAGG - Intergenic
967055232 3:185824734-185824756 CGGCCTGAGCGGGGCGAGGCGGG + Intronic
967264239 3:187676091-187676113 CGGCATGTGCAAATGGAGGTGGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968485868 4:861292-861314 CGTCAAAAGCAGAGGAAGGCCGG + Intronic
968539091 4:1154061-1154083 AGGCAGGAGGGGAGGGAGGCTGG + Intergenic
968542001 4:1172545-1172567 CGGCAGGAGCAGCGGGAGCGCGG + Exonic
968654683 4:1773395-1773417 CCGCATGCCCAGAGGGAGGCCGG - Intergenic
969328766 4:6460912-6460934 CGGGATGGGAAGTGGGAGGCAGG - Intronic
970382932 4:15526101-15526123 TGGGATGTGCAGAGGGAGGTAGG - Intronic
970503055 4:16697617-16697639 AGGCAAGAGCAAAGGAAGGCAGG - Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
972203776 4:36747495-36747517 CCCCAAGAGCACAGGGAGGCTGG - Intergenic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
973216058 4:47670667-47670689 CAGCATGGGCACAGGGAGGCAGG + Intronic
974894297 4:67920286-67920308 AGGGAAGAGCAGAGAGAGGCAGG - Intronic
976074719 4:81284741-81284763 CGGCTGGAGCAGAGGGAGCTGGG - Intergenic
976690035 4:87859022-87859044 AGGCAAGAGGAGAGGGTGGCCGG + Intergenic
976828850 4:89290306-89290328 TGGCCTGAGCAGAGGAATGCAGG - Intronic
976911454 4:90312234-90312256 TGGCATGAGCAGAGTGATGGAGG + Intronic
982190514 4:152850126-152850148 CTGCATCAGCATAGGTAGGCAGG + Intronic
983104746 4:163672830-163672852 GGGCATGAGCCAAGGGATGCAGG - Intronic
984113041 4:175643925-175643947 CCGCATGTGCAGTGGGTGGCCGG - Intronic
984364200 4:178777245-178777267 CACCATGGGCAGAGTGAGGCAGG + Intergenic
985487236 5:158510-158532 TGGGATGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985651274 5:1108891-1108913 GGCCAGGGGCAGAGGGAGGCAGG + Intronic
985818163 5:2141937-2141959 GCGGATGAGCAGATGGAGGCAGG + Intergenic
986184457 5:5422837-5422859 CGGCATCAGCAGAGACAGGACGG + Exonic
987647184 5:20689237-20689259 CGGCATTAGAAAGGGGAGGCTGG + Intergenic
990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG + Intronic
992483782 5:77176502-77176524 GGGCATGAGCAGGAGGAGGGTGG + Intergenic
993168820 5:84389434-84389456 CAGCATGAGCAGAGGGTTGGAGG - Intergenic
993312546 5:86353858-86353880 TGGCAAGAGCAGAAGGCGGCAGG - Intergenic
994106312 5:95953087-95953109 CGGGCTGAGCAGAGGATGGCAGG + Intronic
995059283 5:107796146-107796168 GGGCATGAGCAGAGTGAGCAGGG + Intergenic
995376467 5:111479908-111479930 AGGCATGAGAAGAGGCAGGGAGG - Intronic
995844009 5:116473824-116473846 AGCCATGAGCAAAGGCAGGCAGG + Intronic
997353961 5:133250453-133250475 TGGCATGAGCTGAGGGAAGCAGG + Intronic
997504720 5:134408165-134408187 GGGCAGGGGCAGAGGTAGGCAGG - Intronic
997588549 5:135059066-135059088 CCCCATGAGCTGAGAGAGGCTGG - Intronic
998147031 5:139734796-139734818 CTGGATCAGCAGAGGCAGGCAGG - Intergenic
998466124 5:142345472-142345494 CTGCATGAGCTCAGGTAGGCAGG + Intergenic
998877805 5:146618284-146618306 TGCCATGAGCCAAGGGAGGCAGG + Intronic
999153527 5:149442219-149442241 GGGCACCAGCTGAGGGAGGCTGG + Intergenic
999721519 5:154402241-154402263 GGGCAGGAGCAGAGGGAGAAAGG - Intronic
999866674 5:155708031-155708053 GGGCATGATTAGAGAGAGGCAGG + Intergenic
1000412760 5:160950702-160950724 CCGCAAAAGCAGAGGGAGGTGGG - Intergenic
1002427589 5:179185363-179185385 CCGCCTGAGCAGGGAGAGGCTGG + Intronic
1002742679 5:181444954-181444976 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1002931620 6:1638855-1638877 CTGCATGAGTAGAGTGAGTCTGG + Intronic
1003116416 6:3286649-3286671 GGGCAGGGGCAGGGGGAGGCGGG + Intronic
1003352717 6:5333616-5333638 CACCTTGAGCAGAGGCAGGCAGG + Intronic
1003635737 6:7829814-7829836 CGCCACAAGCAGAGGGAGGTTGG + Intronic
1004407932 6:15351870-15351892 TGTCATCAGCAGAGGGAAGCGGG - Intronic
1005091506 6:22061692-22061714 GGGCAGGAGCAGATGGAGGAAGG - Intergenic
1005994482 6:30922998-30923020 CGGGGTGAGCAGAGGGCAGCGGG + Intronic
1006067105 6:31470062-31470084 CCCCATGAGCTGAAGGAGGCTGG - Intergenic
1006309477 6:33247867-33247889 CGGCATAAGGCGAGGGCGGCAGG - Intergenic
1006500791 6:34457754-34457776 CTCCAAGAGCACAGGGAGGCTGG - Intergenic
1007228196 6:40329305-40329327 CAGCATGAGCAGAGGTTGGGAGG + Intergenic
1007272160 6:40646174-40646196 GGGCATGAGCAGGGGGTGGTGGG - Intergenic
1007680360 6:43629250-43629272 CGGCCTGAGCAGAGTGGGGTGGG + Intergenic
1007746698 6:44047617-44047639 GGGCATGAGCAGAGGGGTGTGGG - Intergenic
1010363211 6:75018868-75018890 GGGAGTGAGGAGAGGGAGGCAGG - Intergenic
1011842368 6:91517409-91517431 GGCCATGAGCAGAGTGAGGAGGG + Intergenic
1012620613 6:101339698-101339720 CAGCATGGCCACAGGGAGGCAGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1017793094 6:157818895-157818917 TGGCATGGGCAGAGAGAGACTGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018633274 6:165838870-165838892 GGACAAGGGCAGAGGGAGGCTGG - Intronic
1018736122 6:166688378-166688400 GGGGATGAGCAGAGGGGGCCGGG - Intronic
1019247814 6:170720693-170720715 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019404715 7:877382-877404 CGGAGGGAGCAGGGGGAGGCTGG - Intronic
1019581780 7:1767789-1767811 CTGCATGAGCAGACGGGGGTGGG - Intergenic
1020007738 7:4791347-4791369 CGGCTGGTGGAGAGGGAGGCCGG + Exonic
1020107354 7:5428265-5428287 CGGCGTGAGCAGCGGGAAGGAGG - Intergenic
1021959019 7:25853962-25853984 CGGTATTTGCAGAGGGAGACGGG - Intergenic
1022155883 7:27662021-27662043 TGGTATGAGAGGAGGGAGGCAGG + Intronic
1022710562 7:32845256-32845278 CGACATGAGCAGGGAGAGGGAGG + Intergenic
1023498575 7:40824377-40824399 AGGCAAGAACAGAGGGAGGAGGG + Intronic
1023638433 7:42236533-42236555 CGGGATGGGCGGAAGGAGGCGGG - Intronic
1023667154 7:42535793-42535815 GGGCTTGAGGAGAGGGAGGGAGG - Intergenic
1023733467 7:43214730-43214752 AGGCATGAGCAGATGCAGGTGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1030174130 7:106632801-106632823 GGGCCTGATAAGAGGGAGGCCGG - Intergenic
1030425995 7:109379139-109379161 AGGCCTGAGGAGAGGGAGACAGG - Intergenic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1033255613 7:139798985-139799007 CGGCAGGTGGAGAAGGAGGCTGG - Intronic
1035368405 7:158363060-158363082 CGTCATGAGCCGAGGGGGACAGG + Intronic
1035500303 8:87171-87193 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035587164 8:785559-785581 GGGCCTGAGGGGAGGGAGGCCGG - Intergenic
1035658852 8:1331823-1331845 AGGCAGGAGCAGAGGGAGAGTGG + Intergenic
1037290527 8:17345223-17345245 CTGCAGGAGCAGAGCGTGGCAGG - Intronic
1039517163 8:38143815-38143837 CGGGAGGAGCAGAGGGCTGCAGG + Exonic
1040976977 8:53204352-53204374 TGGCGAAAGCAGAGGGAGGCAGG + Intergenic
1042874376 8:73427276-73427298 CGGCAGCAGCAGTGGGAGGAGGG + Intronic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044549093 8:93492531-93492553 AGGCATGATCAGAGGCATGCTGG - Intergenic
1044852426 8:96442104-96442126 CGTGATGAGCAGAGTCAGGCTGG + Intergenic
1045269198 8:100647811-100647833 AGGCATTGGCAGGGGGAGGCAGG - Intronic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048140843 8:131792596-131792618 CGGCATGAGACAAGGAAGGCAGG + Intergenic
1049301938 8:141875373-141875395 CGGCGTGTGCTGAGTGAGGCAGG - Intergenic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049440039 8:142605214-142605236 AGGCATGGGGAGAGGGAGTCTGG + Intergenic
1049566349 8:143341130-143341152 CAGCACGAGAAGAGGGTGGCGGG - Intronic
1049607516 8:143536589-143536611 CGCCATGGGCTGAGGGAGGCAGG - Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050119074 9:2289377-2289399 GGGCATCAGCAGAGGGAAGCAGG + Intergenic
1050577434 9:7011848-7011870 CGGCATGAGCAGAGTGCAGATGG - Exonic
1051707465 9:19895761-19895783 CCGCATGAGGAGATGGAGGGTGG - Intergenic
1053139516 9:35673982-35674004 CGGGATCAACAGAGGGAGCCAGG - Exonic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053416067 9:37947548-37947570 AGGCATGGGCAGAGGCAGGTAGG - Intronic
1053753473 9:41279260-41279282 TGGCAGGAGCAGAGGGAGCCTGG + Intergenic
1054258995 9:62843623-62843645 TGGCAGGAGCAGAGCGAGCCTGG + Intergenic
1054332782 9:63776417-63776439 TGGCAGGAGCAGAGGGAGCCTGG - Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1057182937 9:93039664-93039686 GGACATGGGCAGAGGGAGACTGG + Intergenic
1058427896 9:104891600-104891622 CTGCATGATCAGAGTGAGACTGG + Intronic
1058472728 9:105297827-105297849 GGGCATGAGCAGGAGGGGGCTGG - Intronic
1059565452 9:115379744-115379766 TGTCAGGAGCAGAGAGAGGCTGG - Intronic
1059691145 9:116687313-116687335 GCGCGTGCGCAGAGGGAGGCAGG + Exonic
1060452584 9:123756928-123756950 CCACATGAGCAGAGAGAGACAGG + Intronic
1060706464 9:125806277-125806299 TGGCTGGAGCAGAGGGAGGGAGG + Intronic
1061274169 9:129559795-129559817 AGGGAAGAGAAGAGGGAGGCAGG + Intergenic
1061291649 9:129653798-129653820 AGGGCTGAGCAGCGGGAGGCAGG + Intergenic
1062034409 9:134376491-134376513 CTGCCTGAGCAGAGTGTGGCGGG - Intronic
1062630127 9:137459608-137459630 CTGCAGGATCACAGGGAGGCCGG + Intergenic
1203775566 EBV:71309-71331 CGGCAGGAGCACAAGGAAGCAGG - Intergenic
1203608586 Un_KI270748v1:76173-76195 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1185644703 X:1608640-1608662 AGGCATGAGCTGAGTGAGGTGGG - Intergenic
1187128180 X:16474228-16474250 AGACATCAGCAGAGGGAGCCAGG + Intergenic
1190221489 X:48515097-48515119 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190232137 X:48590460-48590482 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1192204813 X:69088797-69088819 GGGCAAGAGCAGAGGAAGGCTGG + Intergenic
1197969599 X:132101289-132101311 TGACATGAGCAGAGGCATGCAGG - Intronic
1198267048 X:135019558-135019580 AGGCATGAGTATAAGGAGGCAGG + Intergenic
1199716017 X:150507860-150507882 GGGCAGGGGCAGATGGAGGCTGG - Intronic
1199970399 X:152855712-152855734 GGCCATGAGCAGAGGCAGGGAGG - Intronic
1201073969 Y:10172680-10172702 AGACATGGGCAGAGAGAGGCCGG + Intergenic