ID: 1047998529

View in Genome Browser
Species Human (GRCh38)
Location 8:130358425-130358447
Sequence CGCTGAGGAGCTGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 150}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047998529_1047998543 16 Left 1047998529 8:130358425-130358447 CCGGCGGCGGCAGCTCCTCAGCG 0: 1
1: 0
2: 1
3: 26
4: 150
Right 1047998543 8:130358464-130358486 GGCTGCGCGCGGGGTCTTCGCGG No data
1047998529_1047998539 -5 Left 1047998529 8:130358425-130358447 CCGGCGGCGGCAGCTCCTCAGCG 0: 1
1: 0
2: 1
3: 26
4: 150
Right 1047998539 8:130358443-130358465 CAGCGGCGGGGGAGGGGACGCGG No data
1047998529_1047998540 5 Left 1047998529 8:130358425-130358447 CCGGCGGCGGCAGCTCCTCAGCG 0: 1
1: 0
2: 1
3: 26
4: 150
Right 1047998540 8:130358453-130358475 GGAGGGGACGCGGCTGCGCGCGG No data
1047998529_1047998541 6 Left 1047998529 8:130358425-130358447 CCGGCGGCGGCAGCTCCTCAGCG 0: 1
1: 0
2: 1
3: 26
4: 150
Right 1047998541 8:130358454-130358476 GAGGGGACGCGGCTGCGCGCGGG No data
1047998529_1047998545 18 Left 1047998529 8:130358425-130358447 CCGGCGGCGGCAGCTCCTCAGCG 0: 1
1: 0
2: 1
3: 26
4: 150
Right 1047998545 8:130358466-130358488 CTGCGCGCGGGGTCTTCGCGGGG No data
1047998529_1047998542 7 Left 1047998529 8:130358425-130358447 CCGGCGGCGGCAGCTCCTCAGCG 0: 1
1: 0
2: 1
3: 26
4: 150
Right 1047998542 8:130358455-130358477 AGGGGACGCGGCTGCGCGCGGGG No data
1047998529_1047998548 25 Left 1047998529 8:130358425-130358447 CCGGCGGCGGCAGCTCCTCAGCG 0: 1
1: 0
2: 1
3: 26
4: 150
Right 1047998548 8:130358473-130358495 CGGGGTCTTCGCGGGGGTCTGGG No data
1047998529_1047998546 19 Left 1047998529 8:130358425-130358447 CCGGCGGCGGCAGCTCCTCAGCG 0: 1
1: 0
2: 1
3: 26
4: 150
Right 1047998546 8:130358467-130358489 TGCGCGCGGGGTCTTCGCGGGGG No data
1047998529_1047998544 17 Left 1047998529 8:130358425-130358447 CCGGCGGCGGCAGCTCCTCAGCG 0: 1
1: 0
2: 1
3: 26
4: 150
Right 1047998544 8:130358465-130358487 GCTGCGCGCGGGGTCTTCGCGGG No data
1047998529_1047998547 24 Left 1047998529 8:130358425-130358447 CCGGCGGCGGCAGCTCCTCAGCG 0: 1
1: 0
2: 1
3: 26
4: 150
Right 1047998547 8:130358472-130358494 GCGGGGTCTTCGCGGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047998529 Original CRISPR CGCTGAGGAGCTGCCGCCGC CGG (reversed) Intronic
900097207 1:944747-944769 CCCTGGGGAGCTGCAGCAGCTGG - Exonic
900254830 1:1692691-1692713 CACTGAGGAGCGGCGCCCGCGGG - Intronic
900263581 1:1745966-1745988 CACTGAGGAGCGGCGCCCGCGGG - Exonic
900523184 1:3115998-3116020 CCCTGGGGAGCTGCAGACGCTGG - Intronic
901660288 1:10794819-10794841 CGCGGAGGAGCTTCCAGCGCCGG + Intronic
902067485 1:13700273-13700295 CTCTGAGGCGCTGGCGCGGCGGG + Intronic
902067519 1:13700393-13700415 CGCTGGGGACCCGGCGCCGCAGG + Intronic
906292984 1:44631998-44632020 AGCTGAAGTGCCGCCGCCGCCGG + Intronic
906627059 1:47333947-47333969 TGCTGAGCCGCTGCCGCAGCGGG + Exonic
909475203 1:76074592-76074614 CACTGAGGAGCCGCCGGCGCCGG + Intergenic
911188602 1:94926966-94926988 CCCCGAGGAGTGGCCGCCGCGGG + Exonic
915070388 1:153261296-153261318 CCCGGAGGAGCCGCCGCCACCGG - Exonic
916802202 1:168226044-168226066 CGCTGAGGAGCTGGAGCTGGTGG + Exonic
920232495 1:204479980-204480002 GGCAGAGGAGCTGCCTCCGCAGG + Intronic
921882651 1:220272244-220272266 CGCTGAGGATCTCCTCCCGCAGG + Exonic
922513207 1:226186678-226186700 CGCTGAGGAGGTGCAGCAGCCGG - Exonic
922526664 1:226309309-226309331 CGGGGAGGAGGTGCCGCCGAAGG + Exonic
924032571 1:239901101-239901123 CTCTGAGCAGCTGCCACCTCTGG + Intronic
924198950 1:241640173-241640195 CGCTGAGGGGCCGGCGCCGGCGG - Exonic
1062801738 10:386049-386071 CTCTGAGGAGCTCCCGCTGGTGG - Intronic
1063380593 10:5583100-5583122 CGCTTAGGTGCTGAGGCCGCAGG + Intergenic
1063670514 10:8096078-8096100 CGGTGAGGAGCAGCCGTCGGTGG + Intergenic
1068900963 10:62268786-62268808 CGCTCTGCAGCTCCCGCCGCCGG + Intergenic
1071814193 10:89215276-89215298 AGCTGTGGAGCTGCTGCCGTAGG + Intronic
1072680034 10:97499405-97499427 CGCTGGGGAGCGGCCCCCTCTGG - Intronic
1076114698 10:127887066-127887088 CGCTGTGGAGGTGCAGCCGTTGG + Intronic
1076817594 10:132922467-132922489 CGTTGAGCAGGTGCCGCCCCGGG - Exonic
1076992065 11:280574-280596 CGCGGACGAGCTGCCGGCGCTGG + Exonic
1078006940 11:7539356-7539378 CTCTGAGGAGCTGTCTTCGCAGG + Intronic
1083039127 11:59669081-59669103 CCCTGCGCAGCCGCCGCCGCCGG - Intergenic
1084411568 11:69009065-69009087 CGCTGTGGAGTGGCGGCCGCAGG - Intronic
1084846435 11:71904092-71904114 CGCTGCTGTGCGGCCGCCGCAGG - Intronic
1084888513 11:72225074-72225096 CGCGGAGGAGCTGCTGGCCCGGG + Exonic
1087836534 11:102880509-102880531 AGCAGAGGTGCTGCCGCGGCTGG - Intergenic
1089195680 11:116692907-116692929 CCCTGAGGAGCAGCCACCCCCGG + Intergenic
1089713737 11:120336522-120336544 CGGGGAGGAGCCGCCGCCTCTGG + Intergenic
1092843010 12:12561758-12561780 CCGAGAGGAGCGGCCGCCGCGGG - Intronic
1098018471 12:66130857-66130879 CGCTGACGAGCTTCCGCCATTGG + Intronic
1098255465 12:68611168-68611190 CGCCGAGGGGCTGCCGCCGCCGG - Intronic
1103559870 12:121788019-121788041 TCCTGAGGAGCTGGGGCCGCAGG + Intronic
1103563347 12:121803884-121803906 GGCGGCGCAGCTGCCGCCGCCGG + Intergenic
1103706824 12:122879422-122879444 CGCTGAGGTGCGGCTGCAGCTGG + Intronic
1105512443 13:21061641-21061663 CGCGGAGGAGCAGGGGCCGCAGG - Intergenic
1106956362 13:34942771-34942793 AGCAGCGGCGCTGCCGCCGCCGG - Exonic
1108600839 13:51993437-51993459 CCCTGAGTAGCTGCCACCACAGG - Intronic
1113438602 13:110311449-110311471 AGCTGAGGGGCTGCCGCCTGGGG + Intronic
1113448382 13:110387802-110387824 CTCTGAGCAGCTGCAGCAGCTGG - Intronic
1113806256 13:113111246-113111268 CCCTGAGGAGGTGCCGCTGGTGG - Intronic
1113937402 13:114001699-114001721 CACGGAGGACCTGCGGCCGCGGG + Intronic
1123862583 15:24484229-24484251 CGCTGAGGAGCTGGGACTGCAGG + Intergenic
1124340422 15:28886423-28886445 GGCTGCGGGGCGGCCGCCGCTGG + Intronic
1127810515 15:62561335-62561357 CGCTGAGGAGGGGCCTCGGCGGG - Intronic
1128119182 15:65133394-65133416 GCCTGAGGCGCCGCCGCCGCCGG - Exonic
1130371105 15:83285477-83285499 CGCGGAGGGGCTGAGGCCGCAGG + Intergenic
1131160715 15:90102904-90102926 CGCGGAGGCGCAGACGCCGCCGG - Intergenic
1131231939 15:90665771-90665793 CGCTCAGGCGGTGCCGCCTCAGG - Intergenic
1132583780 16:697120-697142 CCCAGCGGAGCGGCCGCCGCTGG - Exonic
1134135898 16:11676164-11676186 GGCTGATGCGCTGCAGCCGCAGG - Exonic
1134143551 16:11742529-11742551 CGCAGAGCAGCTCCGGCCGCTGG + Exonic
1139459495 16:67110327-67110349 AGGTGAGGAGCTGCGGGCGCAGG - Intronic
1142315210 16:89339798-89339820 CGCTGAGGAGCAGCCACAGCAGG - Intronic
1145810026 17:27759036-27759058 CGCTGGCCAGCTGCTGCCGCAGG + Exonic
1146171200 17:30635024-30635046 CGCTGAGGGGCTGCTGTGGCTGG - Intergenic
1146344659 17:32051033-32051055 CGCTGAGGGGCTGCTGTGGCTGG - Intronic
1147353211 17:39868332-39868354 CGCTCAGGGGCTGGCGTCGCAGG - Exonic
1147967305 17:44200088-44200110 TGCTGCCGAGCTGCGGCCGCGGG - Intronic
1148167010 17:45490685-45490707 GGCTGAGGGGCTGCCGCGGCCGG - Exonic
1148929977 17:51120341-51120363 CGCTGAGGAGGTGAGGCCGGCGG - Exonic
1149296273 17:55265027-55265049 CGCTGGGGAGCAGCGGCCGCCGG + Exonic
1150398189 17:64837089-64837111 GGCTGAGGGGCTGCCGCAGCCGG - Intergenic
1152015817 17:77749591-77749613 CCCTCAGGAGCTGCCTCTGCTGG + Intergenic
1152049233 17:77959233-77959255 CGCGGAGCCGCCGCCGCCGCCGG + Intergenic
1152378719 17:79931243-79931265 AGATGAGGAGCTGCCCCCACAGG - Intergenic
1152546069 17:81000630-81000652 CGCAGGAGAGCTGCCGCCACGGG - Intronic
1152809473 17:82374771-82374793 CGCTGCGGTGCTGCGGCCGCTGG + Exonic
1153615091 18:6926788-6926810 CCCTGAGGAGCTGGGGCCACAGG - Intergenic
1160805429 19:990404-990426 GGCTGAGGACCTGCGGCTGCTGG - Intronic
1160967641 19:1753627-1753649 CGCTGAGGAGCGCGCGCGGCGGG + Exonic
1162444357 19:10713111-10713133 CGCTCATGAGCTGCAGCTGCGGG - Exonic
1165319018 19:35074609-35074631 CTCTGAGGAGCTGCGGCTGCTGG + Intergenic
1166199316 19:41226273-41226295 CGCGCGGGAGCTGGCGCCGCCGG - Intronic
1167209343 19:48123273-48123295 CCCGGAGCAGCTGCCGGCGCCGG + Exonic
1167571599 19:50292365-50292387 GGCTGAGGTGCTGCGGCTGCAGG + Exonic
1167765939 19:51482540-51482562 CCCTGAGCAGCTGCAGCCTCTGG - Intronic
1168291434 19:55359519-55359541 CGGGGAGGAGCTGACGCAGCTGG + Exonic
1168643367 19:58044601-58044623 TAATGAGGAGCTGCCGCGGCTGG + Intronic
925368342 2:3326024-3326046 CACTGGGGAGCAGCCGCCTCAGG - Intronic
925865065 2:8220099-8220121 AGATGAGGAGCTGCACCCGCTGG + Intergenic
929604230 2:43224765-43224787 CGCCGAGGACCTGCTGGCGCCGG - Exonic
930358252 2:50346961-50346983 CGCCGAGGGGCAGCCGCCGCGGG + Intronic
930730663 2:54724865-54724887 CGCAGACAAGCCGCCGCCGCCGG - Exonic
931614706 2:64144245-64144267 CGCTGAGGAGCCGCGGACGCAGG + Exonic
935165799 2:100567684-100567706 CCCTGAGGAGCTGGAGGCGCTGG + Intronic
938303405 2:130231538-130231560 CCCTGGGGAGCTGCAGCGGCTGG + Intergenic
938453268 2:131442694-131442716 CCCTGGGGAGCTGCAGCGGCTGG - Intergenic
944221724 2:197310404-197310426 CGGAGGGGAGCTGCCGCCGCGGG + Intronic
948903300 2:240966694-240966716 CCCTGAAGAGCTGCCGGGGCTGG + Intronic
948911664 2:241008082-241008104 AGCTGGGGAGCTGCCACCTCCGG - Intronic
1169496735 20:6122896-6122918 AGCTGAGCAGCCGCCGCCACTGG - Exonic
1169832466 20:9839191-9839213 CGTGCAGGAGCTGCCCCCGCCGG - Intergenic
1170007725 20:11687073-11687095 CGCTGTGGTGGTTCCGCCGCGGG + Intergenic
1171173569 20:23035344-23035366 CGCTGAAGAGCTGCGGGCACCGG - Intergenic
1172664690 20:36591034-36591056 CACTGAGGGGCTGCTGCCACGGG - Exonic
1173221606 20:41136967-41136989 CGCGGAGGACCCGCCGCCGCCGG + Exonic
1174066260 20:47867940-47867962 CGCTGAGGAGCGGCCTCAGAGGG + Intergenic
1176411255 21:6450700-6450722 TGCTGAGGTGCTGCCGGCGGGGG - Intergenic
1179686748 21:43059022-43059044 TGCTGAGGTGCTGCCGGCGGGGG - Intronic
1179833441 21:44012502-44012524 CTCTGAGGAGCCGCTGCCGCCGG + Exonic
1180650019 22:17369698-17369720 GGCTGCGGCGCTGCCGCGGCGGG + Exonic
1180710651 22:17837184-17837206 GGCTCAGGAGCTGCCTCTGCAGG + Intronic
1180971991 22:19820596-19820618 ACCTGAGGAGCTGGCGCCCCTGG + Exonic
1181456694 22:23063951-23063973 CGCTGAGGAGCTTCTGCTTCAGG + Exonic
1183165062 22:36141274-36141296 TGCTGAGGAGCTGAGGCGGCAGG - Exonic
1183264527 22:36817185-36817207 CGCTGAGCAGCGCCGGCCGCCGG + Intronic
1183739489 22:39662126-39662148 CGCGGACGAGGGGCCGCCGCGGG + Exonic
1183821172 22:40346843-40346865 TCCTGAGGAGCTGCGGCCCCAGG + Intronic
1184153122 22:42649696-42649718 CGCTGAGCAGCTGCAGGCACAGG - Intergenic
1184296881 22:43530556-43530578 CCCTGAGGAGCTGGCGATGCAGG + Intronic
1185345064 22:50307424-50307446 CGCGGAGCCGCAGCCGCCGCAGG + Intronic
951717448 3:25664466-25664488 CGCTGAGGAGGCCGCGCCGCCGG + Exonic
951906951 3:27715359-27715381 CGCTGCGCACCCGCCGCCGCCGG - Intergenic
954265883 3:49470112-49470134 CGCTGCGGAGCGGCCGACGCAGG + Exonic
955276996 3:57556296-57556318 AGCTGAGGAGCCGAGGCCGCCGG - Exonic
955953857 3:64268096-64268118 CACAGAGCAGCTGCCGCCCCAGG - Intronic
963827559 3:149971132-149971154 CGGTAAGGAGCAGCCGCCACAGG - Intronic
966182138 3:177197335-177197357 AGCGGAGGTGCTCCCGCCGCGGG + Intronic
967124104 3:186409196-186409218 CGCTGAGGAGGGGCCACAGCAGG - Intergenic
968426936 4:530221-530243 CCCTGAGGAGCCGCCGCCACAGG - Intronic
968513120 4:1003886-1003908 GGCTGGGGAGGTGCCGCCGAGGG + Intronic
968541635 4:1171190-1171212 CGCTGAGCCGCTGTCGCCGCAGG - Exonic
968671762 4:1855915-1855937 TACTGAGGAGCTGCCGCGGCCGG - Exonic
968789314 4:2648598-2648620 TGCTGAGGTGCTGCTGCAGCAGG - Intronic
972533073 4:39977618-39977640 CGAGGAGGAGCAGCCGCCGCGGG + Exonic
981782666 4:148444881-148444903 CGCTGCGGAGCGGCGGGCGCGGG - Intergenic
984765648 4:183398565-183398587 GGCTGGTGAGCTGCCGCCCCGGG - Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
986858851 5:11903861-11903883 GACTGAGGAGCTGTCGCCGGCGG - Exonic
992124321 5:73625892-73625914 CGCTGCGGGGCTGCGGCCGTTGG - Intergenic
999662903 5:153884091-153884113 TGCTGAGGAGCTTCCTCCTCTGG + Intergenic
999696269 5:154190770-154190792 GGCTGAGCTGCTGCCGCCGCCGG + Exonic
1000902449 5:166927028-166927050 CGCGCAGGAGCTGACGGCGCAGG + Intergenic
1007630312 6:43269755-43269777 GCCCGAGGAGCCGCCGCCGCCGG - Intronic
1010786283 6:80004743-80004765 CACTGAGGAACAGCCGCAGCCGG + Intronic
1013368826 6:109453785-109453807 CGCTGTGGAGCTGGCGCTGCTGG - Exonic
1017146601 6:151240642-151240664 GGCCGAGGGGCCGCCGCCGCTGG - Exonic
1017737901 6:157380866-157380888 CGCGCAGCAGCTGCCGCCTCGGG - Intergenic
1019162981 6:170081204-170081226 AGGGGAGGAGCTGCAGCCGCAGG + Intergenic
1019327843 7:446891-446913 TGCTGAGGAGCTGCCTCCCGAGG + Intergenic
1019716486 7:2541717-2541739 CCTGGAGGAGCTGCAGCCGCTGG - Exonic
1020217184 7:6202273-6202295 GGCTGAGGTGCTGCAGCAGCTGG - Intronic
1022504612 7:30902540-30902562 GCCTGAGGAGCTGCAGCCCCAGG + Intergenic
1024539660 7:50465996-50466018 CGAGGAGGAGCTGCAGCCGTGGG - Intronic
1026734849 7:72942915-72942937 CGCTGAGGGGCAGCCACCGGGGG + Exonic
1026785182 7:73297827-73297849 CGCTGAGGGGCAGCCACCGGGGG + Intergenic
1027108894 7:75422103-75422125 CGCTGAGGGGCAGCCACCGGGGG - Exonic
1028507126 7:91582900-91582922 CACTGAGGAGCTCCAGCCTCAGG + Intergenic
1028871404 7:95774345-95774367 CTCTGAGATGCTGCAGCCGCTGG + Intronic
1029217906 7:98964990-98965012 CGCTGAGGAGCTGGGACCACAGG - Intronic
1029461096 7:100694214-100694236 CACAGAGGAGCGGCCGCCGCGGG - Intergenic
1033099797 7:138460455-138460477 CTCTGAGGAGCAGCCGCAGGAGG + Exonic
1033673020 7:143511298-143511320 CGCCGACGAGCTGCCTCTGCTGG - Intergenic
1043388198 8:79768139-79768161 CGGGGAGGAGCCGCGGCCGCCGG - Intergenic
1047998529 8:130358425-130358447 CGCTGAGGAGCTGCCGCCGCCGG - Intronic
1048336718 8:133507975-133507997 CACAGAGGAGCTGCCTCCCCTGG + Intronic
1049675816 8:143888547-143888569 GGCTAAAGAGCTGTCGCCGCAGG + Intergenic
1050230920 9:3525588-3525610 CGCTGCGGCGCCGCCGCCGAGGG - Intronic
1054775734 9:69122021-69122043 CTGTGAGGCGCTGCCGCCCCGGG - Intronic
1057410314 9:94811751-94811773 AGCTGAGGAGATGCCGCCTCTGG - Intronic
1057489271 9:95508872-95508894 CGCAGAGCCGCCGCCGCCGCGGG + Intronic
1058686748 9:107487454-107487476 TGCTGGGGAGCTGCCGCCCCAGG + Exonic
1062694474 9:137866440-137866462 GGCTGAGGGGCTGCCCCAGCAGG - Intronic
1185633617 X:1535596-1535618 CGCTGAGGAGCTGAAGCCCGTGG - Intronic
1192503089 X:71665854-71665876 TGCTCAGGAGCTGCCACTGCAGG - Intergenic
1192510296 X:71717232-71717254 TGCTCAGGAGCTGCTGCTGCAGG - Exonic
1192516401 X:71764321-71764343 TGCTCAGGAGCTGCTGCTGCAGG + Exonic
1192529416 X:71872373-71872395 TGCTCAGGAGCTGCCGCTGGAGG - Intergenic
1192894188 X:75423138-75423160 TACTGAGGAGCTGCAGCCACAGG + Intronic
1200202902 X:154294976-154294998 CGCTGTGGAGCTGGCGCCGTTGG + Intronic