ID: 1048003829

View in Genome Browser
Species Human (GRCh38)
Location 8:130402101-130402123
Sequence GTGGCTGTCCAGAAATATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048003826_1048003829 7 Left 1048003826 8:130402071-130402093 CCTTTGTCAGGAATGTTCTTGCA 0: 1
1: 0
2: 2
3: 20
4: 256
Right 1048003829 8:130402101-130402123 GTGGCTGTCCAGAAATATGAAGG 0: 1
1: 0
2: 1
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048003829 Original CRISPR GTGGCTGTCCAGAAATATGA AGG Intronic
900372114 1:2336723-2336745 GAGGCTGTCCAGGAACAGGAAGG + Exonic
900518230 1:3093345-3093367 CTGGCTGTACAGAAATGTGGAGG - Intronic
900861572 1:5236769-5236791 GTCGCTGTTGAGAAATACGATGG + Intergenic
901535162 1:9877960-9877982 GTGGCTGGGCAGAAGTAGGAAGG + Exonic
906355429 1:45102409-45102431 CTAGCTGTCCAAAAAGATGAGGG - Intronic
906647389 1:47485269-47485291 GTGGCTATTAAGAAATATGGTGG + Intergenic
906927938 1:50138911-50138933 GTGGCTGCAAAGCAATATGAAGG + Intronic
907152810 1:52305473-52305495 TTTGCTGTCCAGGAAAATGATGG + Intronic
908578404 1:65486815-65486837 ATGGCTGTCCAGATACCTGATGG + Intronic
909502422 1:76349868-76349890 TTGTCTGTCCAGCAAGATGAGGG + Intronic
911098395 1:94074691-94074713 GAGGCTGTTGAGAAATAGGAAGG + Intronic
911404563 1:97420477-97420499 GTGGCTCTGCAGAAACTTGATGG - Intronic
911879161 1:103212047-103212069 GTGTATGTCCAAAAAAATGAAGG + Intergenic
913382853 1:118229599-118229621 GTGCCTGACCAGACAGATGAGGG - Intergenic
919088663 1:192951404-192951426 CTGGCTGACTAGAAATATTAGGG - Intergenic
1064933770 10:20656994-20657016 GTGACAGTGCAGAAATATAAGGG - Intergenic
1066028937 10:31397480-31397502 ATGCCTGTCCAAAAATAGGAAGG - Intronic
1067133930 10:43591822-43591844 GTCGCTGTCAATAAATATGTGGG + Intergenic
1068798862 10:61116323-61116345 GTGGCTGTTCCCTAATATGATGG + Intergenic
1070522302 10:77264756-77264778 GGGGCTGTGCTGAAATATGCAGG - Intronic
1071007802 10:80902705-80902727 GTGGTTGTCCTCAAATACGAAGG + Intergenic
1071473913 10:86008310-86008332 GTCTTTGTCCAGAAATATTAAGG - Intronic
1072487146 10:95866354-95866376 ATATCTTTCCAGAAATATGAAGG - Exonic
1072825486 10:98601948-98601970 GTAGCTGTCAAGAACTGTGAAGG - Intronic
1077797879 11:5509921-5509943 GTGGCTGTGTAGCAAGATGAGGG - Exonic
1077836563 11:5931867-5931889 GTGCCTGTCCAAAGAAATGAGGG - Intronic
1078523134 11:12079381-12079403 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1079062690 11:17263323-17263345 GAGGCTGGACAGAAAGATGAAGG + Intronic
1080820638 11:35802861-35802883 GTTGCTCTCCAGATATTTGAAGG + Intronic
1084712291 11:70851329-70851351 CTGGCTGTCCACAAAGAAGAAGG + Intronic
1085232493 11:74984541-74984563 GGGGCTGTCAAGAATTGTGAAGG - Intergenic
1095867435 12:46988005-46988027 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1098724562 12:73946629-73946651 CTCCCTGTCTAGAAATATGAAGG - Intergenic
1101299526 12:103464203-103464225 GAGGCTGTGGAGAAATAGGAAGG - Intronic
1102879079 12:116470430-116470452 GTGGTTGTCCACTATTATGAAGG + Intergenic
1104559257 12:129829268-129829290 GTGGCTTTTCTGAAATACGACGG + Intronic
1105617750 13:22035275-22035297 GTGACTTGGCAGAAATATGATGG + Intergenic
1106374922 13:29176871-29176893 GTGACTGTCCAGAGAGAGGAGGG - Intronic
1109597641 13:64577539-64577561 GTAGCTGTGGAGAAATAGGAAGG + Intergenic
1110622049 13:77607882-77607904 GTGACTATGCAGAAATATGTAGG - Intronic
1111534291 13:89581736-89581758 TTGGTTGTCCCGAAATATGTAGG + Intergenic
1111940102 13:94599226-94599248 CTGGCTGACCAGGAATATGCTGG - Intergenic
1112146864 13:96709633-96709655 GTGGCTGTCTATAAATCGGAAGG + Intronic
1114334054 14:21669549-21669571 AGGGCTGCCCAGAAATCTGAAGG + Intergenic
1116510000 14:45733327-45733349 ATGGCTGACTAGAAATAAGAAGG + Intergenic
1117861287 14:60095022-60095044 GTGTCAGTCGAGAAAAATGATGG + Intronic
1120374625 14:83687080-83687102 ATGGTTGTTCAGAAATAAGATGG + Intergenic
1120825944 14:88955565-88955587 GTGGCTTTCCACAAAAATGTAGG - Intergenic
1125368388 15:38943405-38943427 GAGGCTGTCCAGGTATAGGAGGG - Intergenic
1126369483 15:47930510-47930532 GTGGCTGTTAAAAGATATGAGGG + Intergenic
1127431660 15:58916063-58916085 CTGGCTGGCCAGAAAAATTATGG - Intronic
1130565622 15:84992405-84992427 GAGGCTGACCAGAGATAGGACGG + Intronic
1130848792 15:87773389-87773411 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1137265045 16:46861892-46861914 GTGTCTTTCCAGAATTATGAAGG - Intergenic
1141573612 16:84950151-84950173 ATGGCTGTGCAGAAAGCTGAAGG - Intergenic
1143576815 17:7798606-7798628 TTGGGTGTCCACAAAAATGAAGG - Exonic
1144247900 17:13385601-13385623 GTAACTGTTCAGAAATGTGAAGG + Intergenic
1152478194 17:80532239-80532261 ATGGCTGCCCAGAAATATAAAGG - Intergenic
1153895737 18:9557907-9557929 TTGGCTGTACAGGAATCTGAAGG - Intronic
1156982469 18:43306563-43306585 GTGGCTGTCTGGAAAAGTGATGG + Intergenic
1157934511 18:51858403-51858425 TTGGGTACCCAGAAATATGAAGG + Intergenic
1159134187 18:64317684-64317706 GAGGCTGTGGAGAAATATGAAGG - Intergenic
1159890640 18:73949970-73949992 GTGGCTGTGCAGAACCAAGAAGG - Intergenic
1160346859 18:78139357-78139379 GTGGCTCTCCAGACATAAGCAGG + Intergenic
1164612583 19:29642925-29642947 GTGGCTCTCCACAAATTTGTGGG - Intergenic
1165412507 19:35670588-35670610 CTGCCTGTCTAGAAAAATGAAGG - Intronic
1165482934 19:36076151-36076173 GTGGCTATCAAGAAATACTAGGG - Intronic
1168392460 19:56021490-56021512 GTGGTTGTCCAGAGTTTTGAGGG - Intronic
926143482 2:10382842-10382864 GTGGCTGGGCAGAAACAGGAAGG - Intronic
928806083 2:35157405-35157427 GTAGCTGGATAGAAATATGATGG - Intergenic
930307382 2:49692481-49692503 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
931161815 2:59701510-59701532 AAGGCTTTCCAGAAATTTGAAGG + Intergenic
931772693 2:65512148-65512170 GTGGCGGTGCAGAAAGATAAAGG + Intergenic
933589666 2:84218302-84218324 ATGGGTATCCAGAAATTTGAGGG - Intergenic
934868544 2:97837891-97837913 GTGGTTGCCTAGAAATAGGAAGG - Intronic
937230093 2:120393242-120393264 ATGGCTGTCCAGAAGTAGCATGG - Intergenic
938738056 2:134204472-134204494 TTGGCTAGCCAGAACTATGATGG + Intronic
939660408 2:144882007-144882029 GTGGCTTTCAACAAATATGGTGG - Intergenic
941050096 2:160722981-160723003 GAGGCTGTAGAGAAATAGGAAGG - Intergenic
941284116 2:163587630-163587652 TTAGCTGTCTAGAAATATGCTGG + Intergenic
943352246 2:186809410-186809432 GTGGCTGTCCTGATAATTGAAGG - Intergenic
943568059 2:189540119-189540141 GTAGCTCTCCAGAAATATTCGGG + Intergenic
944222159 2:197313308-197313330 CTGGCTCTCCAGGAATATGTAGG - Intergenic
945139386 2:206667567-206667589 ATGGCTGTCTAGAAATTTGAAGG - Intronic
945627327 2:212226889-212226911 GTGGATTTCCATTAATATGAGGG + Intronic
1170909269 20:20548010-20548032 GTGGCAGACCACATATATGATGG - Intronic
1171266996 20:23779610-23779632 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1171276716 20:23862385-23862407 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1172159090 20:32852919-32852941 GTGCCAGACCAGAAAAATGACGG - Intergenic
1172512246 20:35508840-35508862 GTGCCTGTGCAGGTATATGAGGG - Intronic
1173631837 20:44522021-44522043 GTGACTCCCCAGAAACATGACGG + Exonic
1174625421 20:51910423-51910445 TTGCATTTCCAGAAATATGAGGG + Intergenic
1174991713 20:55518090-55518112 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1181999194 22:26906270-26906292 TAGGATGTCCAGGAATATGAGGG - Intergenic
1185163967 22:49246522-49246544 GTGGCTGCCCAGAAATGGGAAGG - Intergenic
950398797 3:12754346-12754368 ATGGCTGTACAGAAAGAGGATGG + Intronic
951357539 3:21686857-21686879 GGGGATGACCAGAAATATAAAGG - Intronic
952445056 3:33373042-33373064 GTGGCTGTCCAGCAACTTGCAGG + Intronic
953827931 3:46270359-46270381 GTGGCTGTAATGAAACATGAGGG + Intergenic
959840866 3:110972626-110972648 ATGGCTGTGGAAAAATATGATGG + Intergenic
963734674 3:149006380-149006402 GTGGCTGTAAAAGAATATGATGG - Intronic
964128883 3:153265841-153265863 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
965133412 3:164730813-164730835 TTGGCTGCTCAGAAATATAAAGG - Intergenic
966016442 3:175144678-175144700 AGGGCTGCCCAAAAATATGAAGG - Intronic
967413418 3:189190489-189190511 GAGGCTGCCCAGAGATTTGAGGG - Intronic
967630084 3:191735579-191735601 GTGGATGTGGAGAAATAGGAAGG + Intergenic
968529954 4:1086525-1086547 GTGGCTGTCAAGGAGTATGATGG + Intronic
968692726 4:2003240-2003262 GAGGCTGTGGAGAAATAGGAAGG + Intronic
969927467 4:10598434-10598456 GAGGCTGTTAAGAAATTTGAGGG + Intronic
972068488 4:34983191-34983213 CTGGCTTTAAAGAAATATGAGGG + Intergenic
972645178 4:40961105-40961127 GTAGCAGTCCACTAATATGATGG - Intronic
973159390 4:46996213-46996235 GTAGCTGTGCAGAAATAGGAAGG + Intronic
976261386 4:83148316-83148338 CTGGCTTACCAGAAAAATGAGGG - Intergenic
976447436 4:85147643-85147665 GTGGCTTTTCAAAAATATGAAGG - Intergenic
977815850 4:101413099-101413121 GAGGCTGTGGAGAAATAGGAAGG + Intronic
981252713 4:142623447-142623469 GTGACTGTGGAAAAATATGAAGG - Intronic
981568395 4:146125452-146125474 GTTATTATCCAGAAATATGAAGG + Intergenic
981763846 4:148224867-148224889 GTAGCTTTCCTGAAATAAGAAGG - Intronic
982776705 4:159449308-159449330 ATGACTGACCAGAAATGTGACGG + Intergenic
983444181 4:167828300-167828322 GTGATTGTCCAGATATATGAGGG + Intergenic
988143192 5:27268792-27268814 CTGGCTTTCCTGAAAGATGAGGG - Intergenic
992088046 5:73295788-73295810 GTGGCTGACGGGAAATATGTTGG + Intergenic
993760226 5:91785877-91785899 ATGGATTTCCAGAAATATGTAGG - Intergenic
994256233 5:97599888-97599910 GGAGCAGTCCAGAAACATGAAGG - Intergenic
996109835 5:119552312-119552334 GAGGCTGTGGAGAAATAGGAAGG - Intronic
998430807 5:142068281-142068303 GTGACTGTTCTGAACTATGACGG - Intergenic
1002977244 6:2092928-2092950 GAGGTTGTCAAGAAATATGAAGG + Intronic
1005321927 6:24663983-24664005 GTTGCTGTACAGAAATACTAAGG + Intronic
1008046308 6:46854714-46854736 GTGGCAGTTCAGCAATCTGATGG - Intronic
1008441555 6:51537547-51537569 GTGGCAGTGCAGAAAGATGGAGG + Intergenic
1010059182 6:71602775-71602797 GTGTCTGTCAATAAAAATGAGGG - Intergenic
1012554581 6:100495971-100495993 GTAGCTGCACAGGAATATGAAGG - Intergenic
1012659965 6:101875438-101875460 TTGGCTGAGCAGATATATGATGG - Intronic
1014431947 6:121381445-121381467 GTGGCAGTGCAGAAAGATGGCGG - Intergenic
1014997861 6:128174290-128174312 GTGGCTATCCAGAAAGAAGAAGG + Intronic
1016487843 6:144562832-144562854 GAGGCTGTGGAGAAATAGGAAGG - Intronic
1016602542 6:145878814-145878836 CTGGCTGCCAAGAAAAATGATGG - Intronic
1017573445 6:155773809-155773831 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1017871828 6:158493478-158493500 CTGGCTGTCCAGAAAAAGAAAGG + Intronic
1018202675 6:161410187-161410209 GTGGGTGGCCAGGAATCTGAAGG + Intronic
1018393468 6:163358913-163358935 ATGGCTGTTCAGAAATGTCAAGG + Intergenic
1019843506 7:3473978-3474000 GTGGATGTCCAAAAATATCGAGG - Intronic
1020525739 7:9256357-9256379 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1020749466 7:12122388-12122410 GAGGTTGTCTAGAAATAGGAAGG - Intergenic
1021029552 7:15714181-15714203 GTGACTGTCCAGACATAGTAAGG + Intergenic
1022327116 7:29342517-29342539 GTGTCTCTTCAGATATATGATGG - Intronic
1026286564 7:68968779-68968801 GTGGCTGTTCTGAGATATCAAGG - Intergenic
1026611867 7:71867251-71867273 GCGTCTGTCAGGAAATATGAGGG + Intronic
1026808324 7:73441995-73442017 GTCTTTGTCCAGAAATATGAAGG - Intronic
1028067831 7:86410319-86410341 GTGGCTGTCTGGGAATAGGAAGG + Intergenic
1029031798 7:97476071-97476093 GTGGTTCTCCATAAATAGGAAGG - Intergenic
1031607073 7:123781623-123781645 GTGGCTAGTCAGAATTATGATGG + Intergenic
1032725688 7:134588360-134588382 CTGGCTGTCAATAAATATGTGGG - Intergenic
1033759018 7:144420868-144420890 GTGCCTGACCAAACATATGAGGG + Intergenic
1037081633 8:14794827-14794849 GTTCCTGTTCAGAAATCTGAGGG - Intronic
1039868314 8:41524947-41524969 ATGGCTGTCCACAAATATTTTGG + Intergenic
1041085244 8:54250546-54250568 TTGGCTGTTAAGAAATTTGATGG + Intergenic
1041646235 8:60255271-60255293 GTGTCTGTCCAGAATTAGGCGGG - Intronic
1042699828 8:71600122-71600144 GTGGCTGCTCAGAAGTAGGAAGG + Intergenic
1044748234 8:95392065-95392087 GGAGCTGTGCAGAAAGATGATGG + Intergenic
1045407512 8:101880985-101881007 GATGCTGTTCAGAAATATTAAGG - Intronic
1045942935 8:107759660-107759682 GTAGCTGGCCAGAAGTAGGAAGG - Intergenic
1046478112 8:114776383-114776405 GTGGCTGCAGTGAAATATGAGGG + Intergenic
1047620135 8:126597966-126597988 GTGGCTGTAAAGAAGTATCAGGG - Intergenic
1048003829 8:130402101-130402123 GTGGCTGTCCAGAAATATGAAGG + Intronic
1048256439 8:132908492-132908514 GTGGCTGTCTAGAAAACTCAAGG - Intronic
1050609391 9:7335908-7335930 GTGGCTGTGCTGAAAAAAGAAGG + Intergenic
1053651091 9:40170583-40170605 GTGGCGGTTCAGCAATTTGATGG + Intergenic
1053901476 9:42799931-42799953 GTGGCGGTTCAGCAATTTGATGG + Intergenic
1054533489 9:66205620-66205642 GTGGCGGTTCAGCAATTTGATGG - Intergenic
1055570438 9:77611149-77611171 GTGGCTATCAAGAACTAAGAAGG + Intronic
1185623720 X:1468637-1468659 GTGGCTGTCCAGAAATTTCTGGG + Intronic
1185667865 X:1781768-1781790 GTGGCTGTTCATGAAGATGATGG + Intergenic
1186113646 X:6282248-6282270 GTTTCTTTCCAGAAATATTAAGG - Intergenic
1186909839 X:14151105-14151127 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1186941417 X:14512156-14512178 ATGGCTGTCCAGAAAGGAGATGG + Intergenic
1188000547 X:24976582-24976604 GTGTCTGTCCAGGAATATTTGGG - Intronic
1190029912 X:46962129-46962151 GTGGCTGCCCAGGAAGATGGAGG + Intronic
1192469870 X:71388666-71388688 GTTGCTGTCAATAAATATCAGGG + Intronic
1193787254 X:85774431-85774453 CTTGCTGTCAAGAAATATGTGGG - Intergenic
1199501645 X:148513551-148513573 GTGGCTGGCTGGAAATATGTGGG + Intronic
1201483299 Y:14464328-14464350 GTTTCTTTCCAGAAATATCAAGG + Intergenic
1202170230 Y:22035607-22035629 CTTGCTGTCAAGAAATATGTGGG + Intergenic
1202221136 Y:22550766-22550788 CTTGCTGTCAAGAAATATGTGGG - Intergenic
1202321977 Y:23644896-23644918 CTTGCTGTCAAGAAATATGTGGG + Intergenic
1202548790 Y:26025160-26025182 CTTGCTGTCAAGAAATATGTGGG - Intergenic