ID: 1048005606

View in Genome Browser
Species Human (GRCh38)
Location 8:130417181-130417203
Sequence GTGTGTGTGCAGTTGTACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 2, 2: 8, 3: 44, 4: 432}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048005606 Original CRISPR GTGTGTGTGCAGTTGTACGT GGG (reversed) Intronic
900137380 1:1123625-1123647 GTGTGTGTGCAGGTGTGCTCAGG - Intergenic
900307964 1:2020055-2020077 GAGTGTGTGCAGGTGGACGGCGG + Intronic
900464609 1:2819296-2819318 GTGTGTGTTCAGGTGTGTGTAGG - Intergenic
900464635 1:2819543-2819565 GCGTGTGTGCAGTTGTGTGGGGG - Intergenic
900563661 1:3321330-3321352 GTGTGTGTACATTTGTGTGTGGG + Intronic
900563703 1:3321856-3321878 GAGTGTGTGCATTTGTGTGTGGG + Intronic
900593567 1:3470366-3470388 GTGTGTGTGTAGGTGTGCATGGG + Intronic
900802240 1:4744612-4744634 GTGTGTGTGCATATGCATGTGGG - Intronic
900908111 1:5575154-5575176 GTGTGTGTGCATGTGTGTGTGGG - Intergenic
901061441 1:6473737-6473759 GTGTGAGAGCACTTGTACCTGGG - Intronic
901205500 1:7493254-7493276 GTTTGTGTGCGTGTGTACGTAGG - Intronic
901574197 1:10186853-10186875 GTGTGTGTGCATGTGTGTGTAGG - Intergenic
901903620 1:12389422-12389444 GTGTGTTTCCAGCTGTACGAAGG - Intronic
902620231 1:17646551-17646573 GTGTGTGTGCACATGGAGGTAGG - Intronic
902786787 1:18738152-18738174 GTGTGTGTGAATGTGTACGTGGG + Intronic
903174503 1:21572892-21572914 GTGTGTGTGCATTTACATGTTGG - Intronic
903283012 1:22261017-22261039 GTGTGTGTGCAGATGTGCGGCGG + Intergenic
903283016 1:22261040-22261062 GTGTGCGTGCAGGTGTGCGGCGG + Intergenic
903296918 1:22349841-22349863 GTGTGTGTGCACGTGCACGTGGG - Intergenic
904205148 1:28849547-28849569 GTGCGTGTGCACGTGTGCGTGGG - Intronic
905246103 1:36614948-36614970 GTGTGTGTGTATATGTATGTAGG + Intergenic
905246351 1:36617017-36617039 GTGTGTGTACAAGTGCACGTGGG + Intergenic
905521510 1:38604050-38604072 TTGTGTGTACAGCTGTCCGTGGG + Intergenic
906514693 1:46432025-46432047 GCGTGTGTGCAGCTGTGCATAGG + Intergenic
908309837 1:62869670-62869692 GTGTGTGTGAAGTAGTATCTTGG + Intergenic
909548651 1:76874934-76874956 GTGTGTTTCCAGTTGTATGAAGG - Intronic
910562182 1:88602197-88602219 GTGTGTTTCCAGTTGTACAAAGG + Intergenic
910838994 1:91543253-91543275 GTGTGTGTGCGGTTATAGGAGGG - Intergenic
912067290 1:105759187-105759209 GTTTGTTTCCAGTTGTACGAAGG + Intergenic
912201776 1:107465939-107465961 GTGTGTGTGCATATGTGTGTGGG + Intronic
915951773 1:160193918-160193940 GTGTGTGTGCAGTGTCAGGTTGG - Intronic
916718889 1:167468078-167468100 GTGTATGTGCATTTATATGTCGG - Intronic
917351100 1:174078506-174078528 GTGTGTGTGTGTGTGTACGTTGG - Intergenic
917505452 1:175623239-175623261 GTGTGTGTGCATATATATGTTGG + Intronic
917958010 1:180120021-180120043 GTGTGTGTGCACATGTAAATTGG - Intergenic
918083238 1:181223419-181223441 GTGTGTGTGTATGTGTATGTGGG + Intergenic
922426055 1:225495229-225495251 GTTTTTGTGCTCTTGTACGTTGG - Exonic
922555947 1:226532015-226532037 GTGTGTGTGCAGGGGTCAGTGGG + Intergenic
922572799 1:226643854-226643876 GTGTGTGTGCAGTGGTGCACAGG - Intronic
922844521 1:228673348-228673370 ATGTTTTTGCAGTTGTAAGTTGG + Intergenic
922907278 1:229183784-229183806 ATGTGTGTGCAGATGTGAGTGGG - Intergenic
923621999 1:235587270-235587292 GTGTGTGTGAAGGTGTGGGTTGG + Intronic
924182269 1:241450897-241450919 GTGTGTTTTCAGTTGTATGCAGG - Intergenic
924840480 1:247705571-247705593 GTGTGTTTCCAGTTGTATGAGGG - Intergenic
1063374299 10:5544835-5544857 GTGTGTGTGCACATGTACGTGGG - Intergenic
1063470003 10:6276858-6276880 GTGTGTGTGTAGTTGTAGGCAGG + Intergenic
1063523870 10:6765371-6765393 GTGTGTGTGCCTTTGTGTGTAGG + Intergenic
1063819041 10:9813204-9813226 GTGTGTTTGCATTTGTATGAAGG - Intergenic
1063838195 10:10040689-10040711 GTGTGTGTGCATGTGTTCATGGG + Intergenic
1066108980 10:32179784-32179806 GTGTGTGTGCAGATGTGGGTGGG + Intergenic
1066467838 10:35668983-35669005 GTGTGCATGCATGTGTACGTGGG + Intergenic
1068151023 10:53131709-53131731 GTGTGTGTGCATTAGTGCATAGG + Intergenic
1068440627 10:57051045-57051067 GTGTGTTTTCACTTATACGTGGG - Intergenic
1069266616 10:66466299-66466321 GTGTGTGTGTGGGTGTAGGTGGG - Intronic
1069718061 10:70533389-70533411 GTGTGTGTGTACCTGTATGTAGG + Intronic
1069790532 10:71017339-71017361 GTGTGTTTCCAGTTGTACAAAGG - Intergenic
1070361331 10:75692597-75692619 GTGTGTGTGTATGTGTATGTAGG + Intronic
1070985414 10:80685806-80685828 GTGTGCGTGCAGTTCTAGGGAGG + Intergenic
1071499313 10:86192179-86192201 GTGTGTGCGCAGGTGTCTGTGGG - Intronic
1072658618 10:97348234-97348256 GTGTGTGTGCAGTTGGGGTTGGG - Intergenic
1073488415 10:103836641-103836663 GTGTGTGTGCACTCGTGTGTTGG - Intronic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1073941390 10:108702822-108702844 ATGTGTGTGCTGATGTACGTAGG + Intergenic
1074355958 10:112783388-112783410 GTGTGTGTGCACGTGCACGCGGG - Intronic
1074372707 10:112913279-112913301 GTGTGTGTGTAGGTGTGTGTGGG + Intergenic
1074833754 10:117269142-117269164 GTATGTGTGCATATGTATGTGGG - Intronic
1075650467 10:124125063-124125085 GTGTGTGTGCATGTGTATGTTGG - Intergenic
1075665092 10:124224207-124224229 TTGTGTGTGCATGTGTATGTTGG - Intergenic
1075707300 10:124509098-124509120 GTGTGTTTGCACTTATAAGTGGG - Intronic
1076755105 10:132565735-132565757 GTGTGTGCGCCGTTGTGTGTGGG + Intronic
1077041955 11:528756-528778 ATGTGTGTGCACGTGTATGTGGG - Intergenic
1077142949 11:1032827-1032849 GTGTGTGTGCATGTGTATATTGG + Intronic
1077223792 11:1429130-1429152 GTGTGTGTGCACGTGTGCATGGG + Intronic
1077270310 11:1674722-1674744 GTGTGTGTCCTGTCGTACGTGGG - Intergenic
1077340377 11:2023769-2023791 GTGTGTGTGCAGGTGTGGGAAGG + Intergenic
1077868863 11:6244573-6244595 GTGTGTGTGTACTGGTAAGTGGG - Intergenic
1077934871 11:6772643-6772665 GTGTGTGTTCATTTGTTCATGGG + Intergenic
1078930342 11:15907570-15907592 GTGTGTGTGCATGTGTATATAGG - Intergenic
1079908428 11:26278859-26278881 GTGTGTGTGCATGTGTGTGTGGG + Intergenic
1080181818 11:29434572-29434594 GTGTGTGTGTGTTTGTAGGTTGG - Intergenic
1081577211 11:44326744-44326766 GTGTGTGTTCACGTGCACGTGGG + Intergenic
1081994795 11:47356509-47356531 GTGTGTGAGCAGGTGTGAGTGGG - Intronic
1081994848 11:47357196-47357218 GTGTGTGTGCAGATATGTGTGGG - Intronic
1083723597 11:64616840-64616862 GTGTGTGTTCAGTTGCACCAAGG - Intronic
1085051341 11:73381765-73381787 GTGTGGGAGCAGGTGGACGTAGG + Intronic
1085761024 11:79241724-79241746 GTGTGTGTGCATGTGTATGGTGG + Intronic
1086580063 11:88389451-88389473 GTGTGTGTGTGTTTGTAAGTGGG - Intergenic
1086585897 11:88450624-88450646 GTGTGTTTTAACTTGTACGTGGG + Intergenic
1087484089 11:98739258-98739280 GTGTGTGTGCATGTGTATATTGG + Intergenic
1087548468 11:99614953-99614975 GTGTGTGTGCATGTGTGTGTAGG + Intronic
1087705376 11:101484635-101484657 GTATGAGTGCAGTTGTCCCTAGG + Intronic
1088844361 11:113652378-113652400 GTGTTTGTGCAGTAATACCTAGG + Intergenic
1089598771 11:119600094-119600116 GTGTGTGTGTAGTGGTGCCTGGG + Intergenic
1089775811 11:120834989-120835011 GTGTGTGTGCAGTGGGGCGTAGG + Intronic
1090833527 11:130437208-130437230 GTGTGTGTGCACATGTGTGTAGG - Intergenic
1091150843 11:133326801-133326823 GTGTGTGTACATTTGTGGGTGGG + Intronic
1091301877 11:134513188-134513210 GTGTGTGTGCAGGTGTGTGTGGG - Intergenic
1091345103 11:134847184-134847206 GTGTGTGTGCACGTGTGTGTAGG + Intergenic
1202823362 11_KI270721v1_random:78958-78980 GTGTGTGTGCAGGTGTGGGAAGG + Intergenic
1091584922 12:1810681-1810703 GTGTGTGTGCATGTGTGCATGGG + Intronic
1091681100 12:2527574-2527596 GTGTGTGTGCATGTGTTAGTAGG - Intronic
1091713777 12:2761537-2761559 GTGTGTGTGCATGTGTGTGTTGG - Intergenic
1092937074 12:13374090-13374112 GTGTGTGTGCATGTGTGTGTTGG + Intronic
1094383827 12:29872478-29872500 GTGTGTGTACAATTTTAAGTAGG + Intergenic
1095584681 12:43836511-43836533 GTGTGTGTGCAGAGATACGGCGG + Intronic
1097596982 12:61645919-61645941 GTGTGTGTGTAGCTGTAGGCAGG - Intergenic
1098219830 12:68257469-68257491 GTGTGTGTGCACACGTGCGTGGG + Intergenic
1098598976 12:72307043-72307065 ATGTGTGTGCATGTGTAGGTAGG + Intronic
1099231544 12:80031634-80031656 TTGTGTGTGCATGTGTGCGTGGG + Intergenic
1099880333 12:88459847-88459869 GTGTGTGTGCACGTGTGTGTTGG + Intergenic
1100741814 12:97602244-97602266 GTGTGTGTGTATGTGTGCGTCGG + Intergenic
1101264596 12:103070503-103070525 GTGTGTGTGTATGTGTATGTAGG - Intergenic
1102316119 12:111889044-111889066 GTGTGTGTGCAGGGGTGGGTGGG + Intronic
1103193824 12:119025125-119025147 GTGTGTGTGTATTTGTGTGTAGG + Intronic
1104792201 12:131490550-131490572 GTGTGTGTGGACTTGTAAGTAGG - Intergenic
1104820831 12:131676354-131676376 GTGTGTGTGCAGGTGTGTGCAGG + Intergenic
1104903854 12:132203339-132203361 TTGTGTGTGCAGGTGTGAGTGGG - Intronic
1106486072 13:30173883-30173905 GTGTGTGTGCACATGTGTGTGGG - Intergenic
1106586179 13:31058293-31058315 GTGTGTGTGGAGTTTTCAGTAGG + Intergenic
1107816021 13:44245099-44245121 GTGTGTGTGCAGGTATATGAAGG - Intergenic
1108213774 13:48163915-48163937 GTGTGTGTGCATGTATATGTGGG + Intergenic
1112261966 13:97885269-97885291 GTGTGTGTGCAGGTGTGTGTGGG - Intergenic
1112261971 13:97885296-97885318 GTGTGTGTGCAGGTGTGTGTGGG - Intergenic
1112439379 13:99415002-99415024 GTGTGTGTGCACGTGTGAGTGGG - Intergenic
1113466433 13:110516740-110516762 GTGTGTGTGCAGCTGTGCAGTGG + Intergenic
1113684715 13:112274951-112274973 GTGTGTTTTCAGTTGTATGTGGG + Intergenic
1113870551 13:113557075-113557097 GTGTGTGTACAGTTGTGCATGGG + Intergenic
1113870561 13:113557182-113557204 GTGTGTGTGCACATGTGTGTAGG + Intergenic
1113870597 13:113557456-113557478 GTGTGTGTGCAGTTGTTTGTAGG + Intergenic
1115413292 14:33101136-33101158 GTGTGTGTGCAGGTGTGTGTGGG - Intronic
1117810076 14:59536329-59536351 GTCTGTGTGCTGTTGTAAATAGG - Intronic
1118036550 14:61874477-61874499 GTGTATGTACAGTTGTTCCTCGG - Intergenic
1118323377 14:64766174-64766196 GTGTGTGTGTATGTGTATGTGGG + Intronic
1118755792 14:68843058-68843080 GTGTGTGTGCACTTGTACACTGG + Intergenic
1119926076 14:78495155-78495177 GTGTGTGTGAAGTTGCATGTTGG + Intronic
1120594409 14:86416208-86416230 GTGTGTTTTCAGTTGTACAAAGG - Intergenic
1120599010 14:86477546-86477568 GTGTGTGTGCATATATATGTAGG - Intergenic
1122088226 14:99321452-99321474 GTGTGTGTGCATGGGTGCGTGGG - Intergenic
1122807487 14:104267410-104267432 GTGTGTGTGCACGTGTGTGTGGG - Intergenic
1122979771 14:105186273-105186295 GTGTGTGTGGAGGTGTGTGTGGG + Intergenic
1123056545 14:105573640-105573662 GTGTGTGAGCAGGTGAGCGTGGG - Intergenic
1123081665 14:105698192-105698214 GTGTGTGAGCAGGTGAGCGTGGG + Intergenic
1124250912 15:28106207-28106229 GTGTGTGTGCATGTGTGTGTGGG + Intergenic
1124349868 15:28947365-28947387 GTGTGTGTGCAGGTGGACAGAGG + Intronic
1124646987 15:31444267-31444289 GTGTGTGTGTAGGTGTGTGTCGG + Intergenic
1126066821 15:44832092-44832114 GTGTGTGTGTAGCTGTATGGTGG - Intergenic
1127448843 15:59096626-59096648 GTATGTGTGCAGATGGACGATGG + Exonic
1127526401 15:59796440-59796462 GTGTGTGTGCATGTGTGTGTTGG - Intergenic
1128659757 15:69490183-69490205 GAGTGTGTGCATTTGCAGGTTGG - Intergenic
1129182949 15:73888397-73888419 GTGTGGGAGCAGTTGTGGGTGGG - Intronic
1129878632 15:78993112-78993134 GGGTGTGTGCATGTGTATGTGGG + Intronic
1130601923 15:85281441-85281463 GTGTGTGTGCATATGTATGTGGG - Intergenic
1130766986 15:86880733-86880755 GTGTGTGTGCATATGTATGTGGG + Intronic
1131366779 15:91848127-91848149 GTGTGTGTGTAGTTGCACAGAGG + Intergenic
1133039218 16:3051174-3051196 GTGTGTGTGCACGTGTGTGTGGG + Intronic
1134102494 16:11461935-11461957 TTGTGGGTGCAGTTGGAGGTTGG + Intronic
1134809147 16:17152287-17152309 ATGTGTGTGCAGTTTTGTGTGGG + Intronic
1135845394 16:25913902-25913924 ATGTGTGTGCATATGTATGTAGG + Intronic
1137273090 16:46915874-46915896 GTGTGTGTGTAGTTGTAGTGTGG - Intronic
1137731313 16:50692859-50692881 GTGTGTGTGCACGTGTGTGTTGG + Intergenic
1138724362 16:59119795-59119817 GTGTGTTTACAGTTGTGCCTGGG + Intergenic
1139328805 16:66171880-66171902 GTGTGTGTGCATGTGTGTGTAGG + Intergenic
1140060783 16:71567978-71568000 GTGTGGGTGTGGTTGTACTTGGG + Exonic
1141568134 16:84917139-84917161 GTGTGTGTGCATTTGTAAAGAGG + Intronic
1141878712 16:86844019-86844041 GTGTGTGTGCATGTGTACCCAGG + Intergenic
1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG + Intergenic
1141928971 16:87188132-87188154 GTGTGTGTACATGTGTGCGTGGG + Intronic
1142289869 16:89188785-89188807 GTGTGTGGGCACCTGTGCGTGGG - Intronic
1142289875 16:89188825-89188847 GTGTGTGGGCACCTGTGCGTGGG - Intronic
1142289880 16:89188853-89188875 GTGTGTGGGCACCTGTGCGTGGG - Intronic
1142289932 16:89189210-89189232 GTGTGTGGGCACCTGTGCGTGGG - Intronic
1142295873 16:89221912-89221934 CTGAGTGTGCAGGTGTATGTGGG + Intronic
1142363718 16:89639055-89639077 GTGTGTGTGCAGGGGTGCGGTGG - Intergenic
1144356178 17:14448558-14448580 GTGTGTGTGGACTTGTGTGTTGG - Intergenic
1145247690 17:21280333-21280355 GTGTGTGTGCATGTGTATTTGGG + Intergenic
1145258570 17:21341403-21341425 GTGTGTGTGCAGGTGAGCTTGGG + Intergenic
1145318055 17:21746602-21746624 GTGTGTGTGCAGGTGAGCTTGGG - Intergenic
1146199701 17:30846298-30846320 GTATGTGTGCATTTGTTTGTGGG - Intronic
1146494721 17:33311448-33311470 GTGTGTGTGTAGATGTGTGTAGG + Intronic
1146532625 17:33622774-33622796 GTATGTGTGCAGCTGTATTTTGG - Intronic
1147028228 17:37608373-37608395 ATGTGTGTGCTGTTGTGTGTTGG + Intronic
1147877809 17:43633928-43633950 GTGTGTGTGTGTGTGTACGTGGG + Intergenic
1148508285 17:48145990-48146012 TTTTGTGTGCATGTGTACGTAGG + Intronic
1148789831 17:50166914-50166936 GTGTGTGTGAAGGTGTGTGTGGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1150927279 17:69546061-69546083 GTGTGTGTTCTGTGGTACCTTGG + Intergenic
1151006600 17:70444915-70444937 GTGTGTGTGCATGTGTGGGTTGG + Intergenic
1151566833 17:74903188-74903210 GTGTGTGTGCATGTGTGTGTGGG - Intergenic
1152191895 17:78893225-78893247 GTGTGTGTGCATGTGTGTGTAGG + Intronic
1152191918 17:78893351-78893373 GTGTGTGTGCAGGGGTGTGTAGG + Intronic
1152271974 17:79330111-79330133 GTGTGTGTGCAGGTGCGTGTGGG + Intronic
1152747344 17:82047443-82047465 GGGTGTGTGCACTTGTGCGTGGG - Intergenic
1153536813 18:6110566-6110588 GTGGGTGTACATGTGTACGTGGG + Intronic
1155709691 18:28860753-28860775 GTGTGTGTACAGTCCTAGGTTGG - Intergenic
1156109815 18:33712727-33712749 GTATGTGTGCATTTGTTAGTTGG + Intronic
1156537909 18:37881493-37881515 GTGTGTTTCCAGTTGTACAAAGG + Intergenic
1156917355 18:42477379-42477401 GTGTGTGTGCATGTGTAGGTAGG + Intergenic
1157700979 18:49761506-49761528 GTGTGAGTGCATGTGTATGTGGG - Intergenic
1158395064 18:57072693-57072715 GTGTGTGTGCACTTGTATTATGG + Intergenic
1159261986 18:66026096-66026118 GTGCGTTTTCAGTTGTATGTGGG - Intergenic
1159556384 18:69949747-69949769 GTGTGGGTGCATGTGTATGTGGG - Intronic
1160109117 18:76008161-76008183 ATGTGTGTGCAGCTGTATATGGG - Intergenic
1160404558 18:78636921-78636943 GTGTGTGTGCATGTGTTTGTGGG + Intergenic
1162778409 19:12994054-12994076 GTGTGTGTGTACATGTACGGAGG + Intergenic
1164827623 19:31296133-31296155 GTGTGTGTGTGATTGTATGTGGG + Intronic
1164882638 19:31747246-31747268 GTGTGTGTGTAGATATATGTAGG + Intergenic
1164882647 19:31747558-31747580 GTGTGTGTGTAGATATATGTAGG + Intergenic
1164941176 19:32253128-32253150 GTGTGTGTGCAGGTGTCTGTGGG - Intergenic
1165060577 19:33203194-33203216 GTGTGTGAGCATTTGTGAGTAGG + Intronic
1165325048 19:35109606-35109628 GTGTGTGTGCAGCCAGACGTGGG + Intergenic
1167103467 19:47417922-47417944 GTGTGTGTGCATGTGTGTGTGGG - Intronic
1167893032 19:52557842-52557864 GTGTGTGTGAAGTCTTACATGGG - Intronic
925088923 2:1137289-1137311 GTGTGTGTGCAGGTGCAGATGGG - Intronic
926046771 2:9715801-9715823 ATGTGTGTGCAGGTGTCCATAGG + Intergenic
926761233 2:16280657-16280679 GTGTGCGTGCAGGTGTCTGTAGG + Intergenic
927326818 2:21814568-21814590 CTATGTTTGCAGTTGTAAGTTGG - Intergenic
927869966 2:26617140-26617162 GTGTGTGTGCACGTGAGCGTGGG + Intronic
928036139 2:27825218-27825240 GTGAGTGTGCATTTGCACATGGG - Intronic
929189996 2:39131011-39131033 GTGTGTTTTCAGTTGTACACAGG + Intergenic
929315853 2:40477751-40477773 GTGTGTGTGCACGTGTGTGTAGG + Intronic
930073257 2:47385737-47385759 GTGTCTTTGTAGTTGTATGTGGG + Intronic
931071590 2:58657691-58657713 GTGTGTGTGCAGGTATATGCTGG - Intergenic
931972847 2:67609045-67609067 GTGTGTGTGTGTGTGTACGTGGG - Intergenic
932922146 2:75928876-75928898 GTGTGTGTGTATTTGTGTGTGGG + Intergenic
933915035 2:86981757-86981779 GTGTATGTGCAGGTGGGCGTGGG + Intronic
934007959 2:87788143-87788165 GTGTATGTGCAGGTGGGCGTGGG - Intronic
935184229 2:100717101-100717123 GTGTGTTTCCAGTTGTATGAAGG + Intergenic
935765768 2:106366469-106366491 GTGTGTGTCCAGGTGTGGGTTGG - Intergenic
935994877 2:108759105-108759127 GTGTATGTGCAGGTGGGCGTGGG + Intronic
936130263 2:109832009-109832031 GTGTATGTGCAGGTGGGCGTGGG + Intronic
936214434 2:110539476-110539498 GTGTATGTGCAGGTGGGCGTGGG - Intronic
936423570 2:112394039-112394061 GTGTATGTGCAGGTGGGCGTGGG - Intronic
936968760 2:118153585-118153607 GTGTGTGTGCACATGTGCTTGGG - Intergenic
938585848 2:132689779-132689801 GTGTGTGTGTATTTATACATGGG + Intronic
940459052 2:153939143-153939165 GTGTGTGTGCTGTTTTATATAGG + Intronic
940670121 2:156657184-156657206 GTGTGTGTGTGGTTGGAGGTGGG + Intergenic
940849783 2:158677075-158677097 GTATGTATGTAGTTGTACGGTGG + Intronic
941952937 2:171175563-171175585 GTGTATGTACAGTTGTCCCTTGG - Intronic
942197690 2:173537911-173537933 GTGGGTGTGGAGGTGCACGTTGG + Intergenic
942346499 2:175007841-175007863 GTGTGTGTGTGTGTGTACGTGGG - Intergenic
942942906 2:181640325-181640347 GTGTGTCTACATGTGTACGTGGG - Intronic
945243179 2:207695660-207695682 GTGTGTGTGCATGTGGATGTTGG - Intergenic
945848286 2:214974708-214974730 GAGTGTGTGCATGTGTATGTGGG - Intronic
946213470 2:218165571-218165593 GTGTCTGTGCATTTGGATGTGGG + Intronic
946427155 2:219605491-219605513 GAGTGTGTGCAGTTTTATATAGG + Intronic
946447560 2:219752475-219752497 GTGTTTGTGCAGTAGCAAGTGGG - Intergenic
946677557 2:222178036-222178058 GTGTGTGTACATGTGTATGTAGG - Intergenic
948026616 2:234783140-234783162 GTGTGTGTGAAATAGTAGGTGGG - Intergenic
948484114 2:238269459-238269481 GAGTGTGTTCAGTTGCAGGTTGG - Intronic
948484117 2:238269504-238269526 GAGTGTGTTCAGTTGCAGGTTGG - Intronic
948484120 2:238269549-238269571 GAGTGTGTTCAGTTGCAGGTTGG - Intronic
948813715 2:240499261-240499283 GTGTGTGTGGATGTGTAAGTGGG + Intronic
949073411 2:242040270-242040292 GTGTGTCTGTAACTGTACGTGGG - Intergenic
1168887470 20:1269546-1269568 CTGTGTGTGCACTTGCAGGTGGG + Intronic
1169551144 20:6702695-6702717 GTGTGAGTGCAGTTGCAGGTGGG - Intergenic
1169751792 20:9002118-9002140 GTGTGTGTGGTGTTGTGGGTGGG - Intergenic
1169757831 20:9062369-9062391 GTGTGTGTGTGTTTGTATGTGGG + Intergenic
1170312308 20:15006167-15006189 GTGTGTGTGTGTGTGTACGTTGG + Intronic
1170828515 20:19819022-19819044 ATGTGTGTGCATGTGCACGTGGG + Intergenic
1171104862 20:22422929-22422951 GTGTGTGTGTGCTTGTATGTAGG - Intergenic
1174112001 20:48203577-48203599 GTGTTTGTGCAGATGCACCTCGG - Intergenic
1174293204 20:49523924-49523946 CTGTGTGTGCATGTGTATGTAGG - Intronic
1175297968 20:57922297-57922319 GTGTGTGTGCATTTGCATGTGGG - Intergenic
1175569027 20:60004971-60004993 GTGTGGGTGCACTTATATGTGGG + Intronic
1176106059 20:63388019-63388041 GTGTGTGTGCATGTGTGTGTGGG - Intergenic
1179304044 21:40138857-40138879 GTGTGTGTGCATGTATATGTGGG + Intronic
1179433114 21:41338735-41338757 GTTTGACTGCAGTTGTACTTAGG + Intronic
1179639407 21:42737224-42737246 GTGTGTGTGCATATGTAGATGGG - Intronic
1180172815 21:46068730-46068752 GTGTGTGTGCACGTGTGCCTGGG + Intergenic
1180172829 21:46068916-46068938 GTGTGTGTGCATGTGTGCCTGGG + Intergenic
1180172871 21:46069500-46069522 GTGTGTGTGCATGTGTGCCTGGG + Intergenic
1182158947 22:28102594-28102616 TTGTGTGTGCAGTTGTACGGTGG - Intronic
1182339217 22:29605928-29605950 GTGTGAGTGCAATTGAAAGTTGG + Intronic
1182849835 22:33463579-33463601 GTGTATGTGTATTTGTACATAGG + Intronic
1182849942 22:33464838-33464860 GTGTGTGTGTATGTGTGCGTGGG - Intronic
1183103880 22:35601433-35601455 GTGTGTGTGCATTTGTGTGAGGG + Intergenic
1183103887 22:35601765-35601787 GTATGTGTGTATTTGTATGTGGG + Intergenic
1183659040 22:39207604-39207626 GTGTGTGTACAGCTGTCTGTGGG - Intergenic
1184491709 22:44813561-44813583 GTGTGTGTGTAGTTGTATGTAGG - Intronic
1184491727 22:44813772-44813794 ATGTGTGTGTAGGTGTATGTAGG - Intronic
1185201641 22:49509704-49509726 GTGTGTTTTCGGTTGTATGTAGG - Intronic
949252040 3:1996853-1996875 GTGTGTGTGTGTGTGTACGTGGG + Intergenic
950941016 3:16891544-16891566 ATGTGTGTGCAGTTGTACTGAGG - Intronic
951428596 3:22579619-22579641 GTGTGTGTGCGTGTGTATGTGGG - Intergenic
953004838 3:38968581-38968603 GTGTGTGTGCACATGTGTGTTGG - Intergenic
953331990 3:42061346-42061368 GTGTGTGTGTGGGTGTGCGTGGG - Intronic
953784446 3:45900267-45900289 GTGTATGTGCATGTGTATGTGGG + Intronic
954764114 3:52898275-52898297 GTGTGTGTGCAGGGGGATGTTGG - Intergenic
954787365 3:53103786-53103808 GTGTGTCTGGAGTTGAACGAGGG + Intronic
955830600 3:62998678-62998700 GTGTGTGTGCAGGAGTGCGTGGG - Intergenic
957800062 3:85066524-85066546 GTGTGCGTGCAGGTGCATGTTGG - Intronic
960366176 3:116775522-116775544 GTGCGTGTGCATGTGCACGTGGG + Intronic
961184815 3:124905619-124905641 GTGTGTGTGTGGTTGTGTGTTGG + Exonic
961863038 3:129933336-129933358 GTGTATCTGCAACTGTACGTGGG + Intergenic
962648667 3:137465828-137465850 GTGTGTGTACAATTGTAATTAGG + Intergenic
963453722 3:145517115-145517137 GTGTGTTTCCAGTTGTACAAAGG - Intergenic
964331982 3:155613011-155613033 GTGTGTGTTAAGTTGTTCATGGG - Intronic
965299134 3:166988390-166988412 GTGTGTTTCCAGTTGTATGAAGG - Intergenic
966555543 3:181255713-181255735 GTGTGTGTGCACGTGTGTGTAGG + Intergenic
966923895 3:184632011-184632033 GTGTGTGTGCATGTGTGTGTAGG - Intronic
968255826 3:197270650-197270672 GTGTGTATGGGGTTGTACTTTGG - Intronic
968523116 4:1043321-1043343 GTGTGCGTGTAGGTGTATGTAGG - Intergenic
968549608 4:1215366-1215388 GTGTGTGGGCAAGTGTGCGTGGG - Intronic
968706215 4:2079514-2079536 GTGTGTGTGCACGTGTGTGTTGG + Intronic
969560212 4:7941986-7942008 GTGAGTGTGCAGGTGTGTGTGGG - Intergenic
969706081 4:8792657-8792679 GTGTGTGTGCATGTGTGTGTGGG - Intergenic
971646307 4:29209072-29209094 TTGTGTGTGGAGTTGAATGTGGG + Intergenic
972171080 4:36346230-36346252 GTGTGTGTGCATGTGTCTGTGGG - Intergenic
972192727 4:36613994-36614016 GTGTGTTTCCAGTTGTCCGAAGG + Intergenic
972338737 4:38131828-38131850 GTGTGTGTGCATGTGTGCGAGGG - Intronic
973290691 4:48467567-48467589 GTGTGTGTGCAGTGGAGGGTGGG + Intergenic
974139705 4:57869816-57869838 GTGTGTGTGCATGTGTGTGTGGG + Intergenic
974289839 4:59914971-59914993 GTGTGTTTCCAGTTGTACGAAGG + Intergenic
974644342 4:64672557-64672579 GTGTGTTTCCAGTTGTACAAAGG - Intergenic
974718470 4:65703136-65703158 GTGTGTGTGCAGTTGTCCCATGG - Intergenic
974756497 4:66215664-66215686 GTGTGTGTGCATATGTGTGTTGG - Intergenic
974805720 4:66877718-66877740 GTATGTGTGCAGTTCAACATTGG - Intergenic
975508863 4:75170455-75170477 GAGTGTGTACAGTTATGCGTGGG - Intergenic
976310332 4:83605376-83605398 GTGTGTGCGCATTTATATGTAGG + Exonic
977898987 4:102396827-102396849 GTGCGTTTCCAGTTGTACGAAGG + Intronic
979075670 4:116266259-116266281 GTGTGTTTCCAGTTGTACAAAGG + Intergenic
980474500 4:133294943-133294965 GTGTGTGTGCACATGTGTGTTGG + Intergenic
981095082 4:140770673-140770695 GTGTGTGTACACTTGTGTGTAGG + Intergenic
981122081 4:141063810-141063832 GTGTCTGTGCATTTGTATGCAGG + Intronic
982160391 4:152563140-152563162 GTATGTGTGCATGTGTATGTTGG - Intergenic
982210875 4:153034889-153034911 GTGTAATTGCTGTTGTACGTAGG - Intergenic
983256975 4:165410846-165410868 GTGTGTGTGCACTTGCACTTTGG + Intronic
983771611 4:171556941-171556963 GTGTGTGTGCACTTGCTGGTTGG + Intergenic
984134572 4:175919692-175919714 GAGTGTGTCCAGTTGTAAATGGG - Intronic
984440796 4:179767196-179767218 GTGTGTGTGGAGTTTTTCCTTGG + Intergenic
985392575 4:189505300-189505322 GTGTGTGTGTAGTTGTGGGCTGG - Intergenic
985606516 5:861065-861087 GTGTGTGTGCAGGTGTGTATGGG - Intronic
985781169 5:1872553-1872575 GTGTGTGTGTAGTGGTAGGGGGG + Intergenic
985949413 5:3211918-3211940 GTGTGTGTGCATTTGGGTGTAGG + Intergenic
985982476 5:3482408-3482430 GTGTGTGTGCATGTGTGTGTGGG - Intergenic
985982478 5:3482434-3482456 GTGTGTATGCATGTGTATGTGGG - Intergenic
986151225 5:5132457-5132479 GTGTGTGTGCAGGAGTAGTTTGG - Intergenic
987466670 5:18280113-18280135 GTGTGTGTGCTTGTGTACATGGG + Intergenic
987505128 5:18759232-18759254 GTGTGTGTGTATGTGTATGTGGG + Intergenic
987578067 5:19756129-19756151 GTGTGTTTCCAGTTGTACAGAGG - Intronic
987880574 5:23739634-23739656 GTGTGTGTGCATGTGTTAGTTGG + Intergenic
988311058 5:29557248-29557270 GAGTGTGTGCAGTTTTAGCTTGG + Intergenic
988528006 5:32003225-32003247 GTGTGTGTGAAGGTATATGTTGG - Intronic
990484479 5:56244272-56244294 GTGTGTTTTCAGTTGTATGTGGG + Intergenic
991013498 5:61908664-61908686 GTGTGTTTCCAGTTGTACCAAGG - Intergenic
991136732 5:63190922-63190944 ATGTGTGTGCATGTGTACATTGG + Intergenic
992225293 5:74614484-74614506 GTGTGTGTGTATTTGTGTGTGGG - Intergenic
992730616 5:79664192-79664214 ATGTGTGTACAGTTGTCCCTTGG - Intronic
994548052 5:101193968-101193990 GTGTGTGTGTATATGTATGTAGG - Intergenic
994954925 5:106515956-106515978 GTGTGTGTACAGTAGTCCCTTGG - Intergenic
995095613 5:108232274-108232296 GTGTGTTTCCAGTTGTACAAAGG + Intronic
999445851 5:151638808-151638830 GTGTGTGTGCATGTGTGGGTGGG - Intergenic
999668862 5:153940817-153940839 GTGTGTGTGCATGTGCATGTGGG - Intergenic
1000123529 5:158221064-158221086 GTGTGTGTGCTGTAGTCCCTAGG + Intergenic
1000719323 5:164686902-164686924 GTGTGAGTGTAGGTGTACATCGG + Intergenic
1001844985 5:174914496-174914518 GTGTGTGTGCACGTGTGTGTTGG - Intergenic
1002095888 5:176830654-176830676 GTGTGTGTGCTGGTGTGTGTGGG + Intronic
1002394917 5:178945228-178945250 CTGTGTGTGTATTTGTATGTTGG + Intronic
1002477669 5:179477682-179477704 CTGTGTGTGCATGTGCACGTAGG + Intergenic
1002778585 6:349213-349235 GTGTGAGTGCACTTGTGTGTGGG + Exonic
1002998268 6:2306995-2307017 GTGTGTTTCCAGTTGTATGAAGG + Intergenic
1003426703 6:6002713-6002735 GTGTGTGAGCAGGTGTGGGTGGG + Intronic
1005980140 6:30830368-30830390 GTGTGTGTGGGGTTCTATGTGGG + Intergenic
1006638169 6:35474889-35474911 GTGTGTGTGCTGGGGTAGGTGGG + Exonic
1006774440 6:36581075-36581097 GTGTGTGTGCATGTGTGTGTCGG + Intergenic
1007698927 6:43754045-43754067 GTGTGTGTGCATGTGTGTGTAGG + Intergenic
1007707318 6:43798814-43798836 GTGTGTGTGCAGGGGTGAGTGGG + Intergenic
1008913736 6:56764084-56764106 GTGTGTGTGCATGTGCACTTTGG - Intronic
1008996524 6:57666056-57666078 GTGTGTTTCCAGTTGTATGAAGG + Intergenic
1012235585 6:96810720-96810742 GTGTTTGTGCATATGTACATAGG + Intronic
1012316774 6:97791017-97791039 GTGTGTGAGCAAGTGGACGTGGG + Intergenic
1013895299 6:115080945-115080967 GTGTGTGTGTATATGTATGTAGG - Intergenic
1017908267 6:158771589-158771611 GTGTGTGTGCGGTTATGTGTGGG + Intronic
1017908281 6:158771669-158771691 GTGTGTGTGCAGTTGTGTGTGGG + Intronic
1018430790 6:163720698-163720720 GTGTGTGTGAAGTCATTCGTGGG + Intergenic
1018661120 6:166088062-166088084 GTGTGTGTGTGGTTGTGTGTGGG + Intergenic
1018816712 6:167337756-167337778 GTGTGTGTGCATGTGTGTGTAGG - Intronic
1019127876 6:169853044-169853066 GTGTGTGTGCATCTGTATGCAGG + Intergenic
1019397868 7:832602-832624 GTGAGTGTGCACCTGCACGTGGG + Intronic
1019601753 7:1887219-1887241 GTGTGTGAGCATGTGTATGTGGG + Intronic
1019643839 7:2118670-2118692 GTGTGTGGGCAGCAGTATGTGGG - Intronic
1020017125 7:4837588-4837610 GTGTGTGTGCATTTTTGTGTGGG - Intronic
1020074709 7:5250213-5250235 GTGTGTGTGCATGTGTGTGTGGG + Intergenic
1020214573 7:6179895-6179917 GTGTGTGTGTGGTTGTGTGTGGG - Intronic
1021194695 7:17662399-17662421 GTGTGTGTGTAGGTGTATGTGGG - Intergenic
1021464083 7:20922053-20922075 GTGTGTGTGCACGTGTGTGTGGG + Intergenic
1022957805 7:35397505-35397527 GTGTGTGTGCACATGTGTGTGGG + Intergenic
1023765704 7:43508577-43508599 GTGTGTGTGTATGTGTATGTGGG - Intronic
1023867753 7:44246394-44246416 ATGTGTGTGCACTTGTGTGTTGG - Intronic
1024352725 7:48383349-48383371 GTGTGTGTGCATATGTATGTGGG + Intronic
1024659274 7:51477665-51477687 GGGTGTGTGTAGGTGCACGTGGG + Intergenic
1025715589 7:63952846-63952868 GTGTGTGTACTGTTCTAAGTAGG - Intergenic
1026445390 7:70480214-70480236 GTGTGTGTGCACATGCACTTAGG + Intronic
1027548839 7:79565054-79565076 GTGTGTGTGTATGTGTATGTTGG + Intergenic
1027619605 7:80467328-80467350 TTGTGTGTGCAGATTGACGTAGG + Intronic
1029440354 7:100583822-100583844 GTGTGTGTGCATGTGGACGAAGG + Intronic
1029842534 7:103381565-103381587 GTGTGTGTGTATATGTATGTAGG - Intronic
1031682288 7:124689474-124689496 GTGTGCTTCCAGTTGTACGAAGG + Intergenic
1033452152 7:141471572-141471594 GTGTGCGTGCATGTGTACTTTGG + Exonic
1033907405 7:146222572-146222594 GTGTGCGTGCACATGTATGTAGG + Intronic
1033955717 7:146845065-146845087 ATGTGTATGCATTTGTACATGGG - Intronic
1034402606 7:150874927-150874949 GTGTGTGTGCATGTGTGTGTGGG - Intergenic
1034823028 7:154234668-154234690 GTGTGTGTGCATGTGTGTGTTGG - Intronic
1034869549 7:154671851-154671873 GTGTGTGTGCATGTGTGTGTTGG - Intronic
1035226143 7:157433501-157433523 GTGTGTGTGCATGTGTGGGTGGG - Intergenic
1035925695 8:3725508-3725530 GTGTGTGTGTATGTGTATGTGGG + Intronic
1036548529 8:9795868-9795890 CTGTGTGTTTAGTTGTATGTGGG - Intergenic
1037162620 8:15791280-15791302 GTGTGTGTGTGTTTGTGCGTGGG - Intergenic
1037168714 8:15863551-15863573 GTGTGTTTGCATTTGTATGTAGG + Intergenic
1037702096 8:21284581-21284603 GTGTGTGTCCACTTATATGTGGG - Intergenic
1037735906 8:21565983-21566005 GTGTGTGTGCACGTGCACGTGGG + Intergenic
1038567985 8:28635702-28635724 GTGTGTGTGGAGTTGTGGGGGGG - Intronic
1040400102 8:47041648-47041670 TTATGTGTGCAGATGTAGGTTGG - Intergenic
1041804061 8:61831040-61831062 GTGTTTGTGCTGTAGTAAGTTGG + Intergenic
1042521252 8:69713504-69713526 GTGTGTATGCAGTTGTTTGTGGG - Intronic
1043126543 8:76403684-76403706 GTGTGTGTGCATATGTATGTGGG - Intergenic
1043880676 8:85539195-85539217 GTGTGTTTGCATCTGTATGTGGG - Intergenic
1044689759 8:94865042-94865064 ATGTGTGTGTATTTGCACGTGGG + Intronic
1044836833 8:96303767-96303789 GAGTGTGTGCAGTTTTACGTGGG + Intronic
1046128360 8:109939145-109939167 GTGTGTTTCCAGTTGTATGAAGG - Intergenic
1046610384 8:116416931-116416953 GTGTGTGTGCATGTGTATGTGGG - Intergenic
1046888254 8:119393138-119393160 GTGGGTGTGTAGTTGTTCCTAGG - Intergenic
1047774487 8:128058404-128058426 GTGTGTGTATAGTTGTATGGTGG + Intergenic
1048005598 8:130417039-130417061 GTGTGTATGCAGTTGTACATGGG - Intronic
1048005600 8:130417083-130417105 GTATGTGTGCAGTTGTACATGGG - Intronic
1048005602 8:130417120-130417142 TTCTGTGTGCAGTTGTACATGGG - Intronic
1048005604 8:130417149-130417171 GTGTGTGTGCAGTTGTACATGGG - Intronic
1048005606 8:130417181-130417203 GTGTGTGTGCAGTTGTACGTGGG - Intronic
1048005608 8:130417213-130417235 GTATGTGTGCAGTTGTACGTGGG - Intronic
1048005610 8:130417254-130417276 GTGTGCATGCAGTTGGACTTGGG - Intronic
1048293779 8:133199687-133199709 GCGTGTGTGCATGTGTATGTAGG - Intronic
1048974471 8:139663193-139663215 GTGTGTGTGCATGTGTATGTGGG - Intronic
1049469595 8:142769426-142769448 GTGTGTGTGCACGTGCACGAAGG + Intronic
1049525451 8:143123719-143123741 GGGTGTGTGCACATGTATGTGGG - Intergenic
1051840403 9:21391136-21391158 GTGTGTGTGTGTGTGTACGTTGG + Intergenic
1053003157 9:34589044-34589066 GTGTGTGTGCATGTGTGTGTCGG - Intronic
1053485525 9:38452105-38452127 GTGTGTGTGCACATGTACCTGGG - Intergenic
1053512570 9:38701159-38701181 GTGTGTGTGTATGTGTACATTGG + Intergenic
1053611080 9:39713610-39713632 GTGTGTCTTCAGTGGTACATGGG + Intergenic
1053869123 9:42471661-42471683 GTGTGTCTTCAGTTGTACATGGG + Intergenic
1054087174 9:60757548-60757570 GTGTGTCTTCAGTGGTACATGGG - Intergenic
1054161282 9:61673497-61673519 GTGTGTGTGCCGCTGTGGGTGGG - Intergenic
1054242440 9:62628785-62628807 GTGTGTCTTCAGTGGTACATGGG - Intergenic
1054556567 9:66663303-66663325 GTGTGTCTTCAGTGGTACATGGG - Intergenic
1055111585 9:72565567-72565589 GTGTGTGTGTATGTGTATGTTGG + Intronic
1055796371 9:79978794-79978816 GAGTGTGTGAAGTTGTCTGTAGG + Intergenic
1056179533 9:84068670-84068692 GTGTGTGTGTAGTTGGTCTTGGG + Intergenic
1056910329 9:90694943-90694965 GTGTGTGTGGATTTGTGTGTGGG + Intergenic
1057632163 9:96728439-96728461 TTTTGTGTGCAATTGTACATAGG - Intergenic
1058321237 9:103634076-103634098 GTGTGTGTGCACGTGTGTGTAGG - Intergenic
1058772805 9:108254132-108254154 GTGTGTGTGCTTTTGTACAGAGG - Intergenic
1058997146 9:110310217-110310239 GTGTGTGTGCATGTGTATATTGG + Intronic
1059350944 9:113664376-113664398 GTATTTGTGGAGTTGTAAGTAGG + Intergenic
1061005898 9:127928264-127928286 GGGTGTGTGCAGTTGGTCCTGGG + Intronic
1061887558 9:133600168-133600190 GTCTGTGTGCATGTGTATGTGGG + Intergenic
1061935304 9:133854220-133854242 GTATGTGTGCAGGTGCACATGGG - Intronic
1061935309 9:133854294-133854316 GTGTGTGTGCAGGTGCACATGGG - Intronic
1062127237 9:134870314-134870336 GTGTGGGTGCAGAGGTCCGTGGG + Intergenic
1062135871 9:134927896-134927918 GTGTGCTTCCAGTTGTACGAAGG + Intergenic
1062355775 9:136161371-136161393 GTGTGTGTGCATATGTGTGTGGG + Intergenic
1185589824 X:1268631-1268653 GTGTGTGTGTAGATGTGTGTGGG + Intergenic
1185943679 X:4350364-4350386 GTGTGTGTGCATGTGTGTGTAGG + Intergenic
1186380911 X:9057958-9057980 GTGTGTGTGCACTTGTAACTGGG + Intronic
1187808188 X:23144343-23144365 GTGCATTTTCAGTTGTACGTAGG + Intergenic
1190155279 X:47986460-47986482 GTGTGCTTCCAGTTGTACGAGGG + Intronic
1190217778 X:48491579-48491601 ATGTCTGTGCACATGTACGTGGG + Intergenic
1190680328 X:52821096-52821118 GTGTGTGTGCACGTGTGGGTGGG - Intergenic
1190878897 X:54478829-54478851 GTGTATATACAGTTTTACGTTGG - Intronic
1191957951 X:66666793-66666815 GTGTGTGTGCATGTGTAGGGGGG + Intergenic
1192626077 X:72730077-72730099 GTGTGTTTTCACTTATACGTAGG - Intergenic
1193846231 X:86474664-86474686 GTGTGTGTGGAGTTGTTTCTGGG + Intronic
1194008322 X:88525549-88525571 GTGTGTGTGTTGTTTTAAGTTGG - Intergenic
1194116207 X:89901620-89901642 GTGTGTTTTCAGTTGTACACAGG + Intergenic
1194168036 X:90546098-90546120 GTGTGTGTGTGTTTGTATGTAGG - Intergenic
1194443806 X:93963326-93963348 GTGTGTTTCCAGTTGTACAAAGG + Intergenic
1194584388 X:95715274-95715296 GTGTGTTTCCAGTTGTACAAAGG + Intergenic
1194692188 X:97000604-97000626 GTGTGTATTCATTTGTATGTGGG - Intronic
1194894828 X:99427389-99427411 GTGTGTGTGTTGTTGCAGGTTGG - Intergenic
1194965661 X:100285839-100285861 GTGTGTGTGTATTTGTGTGTGGG - Intergenic
1195398449 X:104436237-104436259 GAGTGTGTGCAGTTGTGCACAGG - Intergenic
1195748623 X:108143018-108143040 GTGCGTTTCCAGTTGTACGAAGG - Intronic
1196605391 X:117651801-117651823 GTGTGTTTTCAGTTGTACAAAGG + Intergenic
1197592155 X:128421612-128421634 GTGTGTTTCCGGTTGTACGAAGG + Intergenic
1198890419 X:141388847-141388869 GTGTGTGTGCAATTATAAATTGG - Intergenic
1199872141 X:151908757-151908779 GTATGTGTGCAGGTCTATGTTGG - Intergenic
1200469006 Y:3558745-3558767 GTGTGTTTTCAGTTGTACACAGG + Intergenic
1200514287 Y:4123894-4123916 GTGTGTGTGTGTTTGTATGTAGG - Intergenic