ID: 1048008022

View in Genome Browser
Species Human (GRCh38)
Location 8:130434821-130434843
Sequence TATCACATGAGACAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048008019_1048008022 3 Left 1048008019 8:130434795-130434817 CCTGAGGGAACTTCTAGGGGAAA 0: 1
1: 0
2: 3
3: 19
4: 188
Right 1048008022 8:130434821-130434843 TATCACATGAGACAGGAAGCAGG No data
1048008012_1048008022 19 Left 1048008012 8:130434779-130434801 CCCATATTGATGAGGTCCTGAGG 0: 1
1: 0
2: 1
3: 4
4: 71
Right 1048008022 8:130434821-130434843 TATCACATGAGACAGGAAGCAGG No data
1048008014_1048008022 18 Left 1048008014 8:130434780-130434802 CCATATTGATGAGGTCCTGAGGG 0: 1
1: 0
2: 1
3: 6
4: 96
Right 1048008022 8:130434821-130434843 TATCACATGAGACAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048008022 Original CRISPR TATCACATGAGACAGGAAGC AGG Intronic
No off target data available for this crispr