ID: 1048009828

View in Genome Browser
Species Human (GRCh38)
Location 8:130446613-130446635
Sequence AGACAGTTTCTCTGTACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048009828_1048009833 12 Left 1048009828 8:130446613-130446635 CCCTCTGTACAGAGAAACTGTCT No data
Right 1048009833 8:130446648-130446670 CCCCCTTTCTCCTCTCTACCAGG No data
1048009828_1048009840 27 Left 1048009828 8:130446613-130446635 CCCTCTGTACAGAGAAACTGTCT No data
Right 1048009840 8:130446663-130446685 CTACCAGGAGGCTTTCTCAAGGG No data
1048009828_1048009839 26 Left 1048009828 8:130446613-130446635 CCCTCTGTACAGAGAAACTGTCT No data
Right 1048009839 8:130446662-130446684 TCTACCAGGAGGCTTTCTCAAGG No data
1048009828_1048009837 15 Left 1048009828 8:130446613-130446635 CCCTCTGTACAGAGAAACTGTCT No data
Right 1048009837 8:130446651-130446673 CCTTTCTCCTCTCTACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048009828 Original CRISPR AGACAGTTTCTCTGTACAGA GGG (reversed) Intergenic
No off target data available for this crispr