ID: 1048009832

View in Genome Browser
Species Human (GRCh38)
Location 8:130446648-130446670
Sequence CCTGGTAGAGAGGAGAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048009832_1048009839 -9 Left 1048009832 8:130446648-130446670 CCCCCTTTCTCCTCTCTACCAGG No data
Right 1048009839 8:130446662-130446684 TCTACCAGGAGGCTTTCTCAAGG No data
1048009832_1048009843 -1 Left 1048009832 8:130446648-130446670 CCCCCTTTCTCCTCTCTACCAGG No data
Right 1048009843 8:130446670-130446692 GAGGCTTTCTCAAGGGCTGTGGG No data
1048009832_1048009844 15 Left 1048009832 8:130446648-130446670 CCCCCTTTCTCCTCTCTACCAGG No data
Right 1048009844 8:130446686-130446708 CTGTGGGATCTTGCCTAGCCTGG No data
1048009832_1048009842 -2 Left 1048009832 8:130446648-130446670 CCCCCTTTCTCCTCTCTACCAGG No data
Right 1048009842 8:130446669-130446691 GGAGGCTTTCTCAAGGGCTGTGG No data
1048009832_1048009840 -8 Left 1048009832 8:130446648-130446670 CCCCCTTTCTCCTCTCTACCAGG No data
Right 1048009840 8:130446663-130446685 CTACCAGGAGGCTTTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048009832 Original CRISPR CCTGGTAGAGAGGAGAAAGG GGG (reversed) Intergenic
No off target data available for this crispr