ID: 1048009837

View in Genome Browser
Species Human (GRCh38)
Location 8:130446651-130446673
Sequence CCTTTCTCCTCTCTACCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048009828_1048009837 15 Left 1048009828 8:130446613-130446635 CCCTCTGTACAGAGAAACTGTCT No data
Right 1048009837 8:130446651-130446673 CCTTTCTCCTCTCTACCAGGAGG No data
1048009831_1048009837 -10 Left 1048009831 8:130446638-130446660 CCAAAGCAGGCCCCCTTTCTCCT No data
Right 1048009837 8:130446651-130446673 CCTTTCTCCTCTCTACCAGGAGG No data
1048009829_1048009837 14 Left 1048009829 8:130446614-130446636 CCTCTGTACAGAGAAACTGTCTA No data
Right 1048009837 8:130446651-130446673 CCTTTCTCCTCTCTACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048009837 Original CRISPR CCTTTCTCCTCTCTACCAGG AGG Intergenic
No off target data available for this crispr