ID: 1048009839

View in Genome Browser
Species Human (GRCh38)
Location 8:130446662-130446684
Sequence TCTACCAGGAGGCTTTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048009832_1048009839 -9 Left 1048009832 8:130446648-130446670 CCCCCTTTCTCCTCTCTACCAGG No data
Right 1048009839 8:130446662-130446684 TCTACCAGGAGGCTTTCTCAAGG No data
1048009829_1048009839 25 Left 1048009829 8:130446614-130446636 CCTCTGTACAGAGAAACTGTCTA No data
Right 1048009839 8:130446662-130446684 TCTACCAGGAGGCTTTCTCAAGG No data
1048009834_1048009839 -10 Left 1048009834 8:130446649-130446671 CCCCTTTCTCCTCTCTACCAGGA No data
Right 1048009839 8:130446662-130446684 TCTACCAGGAGGCTTTCTCAAGG No data
1048009831_1048009839 1 Left 1048009831 8:130446638-130446660 CCAAAGCAGGCCCCCTTTCTCCT No data
Right 1048009839 8:130446662-130446684 TCTACCAGGAGGCTTTCTCAAGG No data
1048009828_1048009839 26 Left 1048009828 8:130446613-130446635 CCCTCTGTACAGAGAAACTGTCT No data
Right 1048009839 8:130446662-130446684 TCTACCAGGAGGCTTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048009839 Original CRISPR TCTACCAGGAGGCTTTCTCA AGG Intergenic
No off target data available for this crispr