ID: 1048009843

View in Genome Browser
Species Human (GRCh38)
Location 8:130446670-130446692
Sequence GAGGCTTTCTCAAGGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048009834_1048009843 -2 Left 1048009834 8:130446649-130446671 CCCCTTTCTCCTCTCTACCAGGA No data
Right 1048009843 8:130446670-130446692 GAGGCTTTCTCAAGGGCTGTGGG No data
1048009831_1048009843 9 Left 1048009831 8:130446638-130446660 CCAAAGCAGGCCCCCTTTCTCCT No data
Right 1048009843 8:130446670-130446692 GAGGCTTTCTCAAGGGCTGTGGG No data
1048009836_1048009843 -4 Left 1048009836 8:130446651-130446673 CCTTTCTCCTCTCTACCAGGAGG No data
Right 1048009843 8:130446670-130446692 GAGGCTTTCTCAAGGGCTGTGGG No data
1048009835_1048009843 -3 Left 1048009835 8:130446650-130446672 CCCTTTCTCCTCTCTACCAGGAG No data
Right 1048009843 8:130446670-130446692 GAGGCTTTCTCAAGGGCTGTGGG No data
1048009832_1048009843 -1 Left 1048009832 8:130446648-130446670 CCCCCTTTCTCCTCTCTACCAGG No data
Right 1048009843 8:130446670-130446692 GAGGCTTTCTCAAGGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048009843 Original CRISPR GAGGCTTTCTCAAGGGCTGT GGG Intergenic
No off target data available for this crispr