ID: 1048014408

View in Genome Browser
Species Human (GRCh38)
Location 8:130484526-130484548
Sequence AACAACCCCAGAGAGAGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048014404_1048014408 9 Left 1048014404 8:130484494-130484516 CCTGGTTGGTGTCAGGCCTCAAC No data
Right 1048014408 8:130484526-130484548 AACAACCCCAGAGAGAGACTAGG No data
1048014405_1048014408 -7 Left 1048014405 8:130484510-130484532 CCTCAACCTGAACCAGAACAACC No data
Right 1048014408 8:130484526-130484548 AACAACCCCAGAGAGAGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048014408 Original CRISPR AACAACCCCAGAGAGAGACT AGG Intergenic