ID: 1048018946

View in Genome Browser
Species Human (GRCh38)
Location 8:130520582-130520604
Sequence TGTTCCACCATTTCAGTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048018942_1048018946 19 Left 1048018942 8:130520540-130520562 CCATATTTGTGTTCTGAGAAGAT No data
Right 1048018946 8:130520582-130520604 TGTTCCACCATTTCAGTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048018946 Original CRISPR TGTTCCACCATTTCAGTCGG TGG Intergenic
No off target data available for this crispr