ID: 1048019912

View in Genome Browser
Species Human (GRCh38)
Location 8:130528425-130528447
Sequence GGTTCTCTGCAGAAATTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048019902_1048019912 4 Left 1048019902 8:130528398-130528420 CCCACCCATATTCCTTTAGAGAG No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019895_1048019912 18 Left 1048019895 8:130528384-130528406 CCCCCGCAGCCCACCCCACCCAT No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019906_1048019912 0 Left 1048019906 8:130528402-130528424 CCCATATTCCTTTAGAGAGGGAG No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019891_1048019912 27 Left 1048019891 8:130528375-130528397 CCAGCCCCACCCCCGCAGCCCAC No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019901_1048019912 5 Left 1048019901 8:130528397-130528419 CCCCACCCATATTCCTTTAGAGA No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019892_1048019912 23 Left 1048019892 8:130528379-130528401 CCCCACCCCCGCAGCCCACCCCA No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019903_1048019912 3 Left 1048019903 8:130528399-130528421 CCACCCATATTCCTTTAGAGAGG No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019899_1048019912 9 Left 1048019899 8:130528393-130528415 CCCACCCCACCCATATTCCTTTA No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019907_1048019912 -1 Left 1048019907 8:130528403-130528425 CCATATTCCTTTAGAGAGGGAGG No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019898_1048019912 15 Left 1048019898 8:130528387-130528409 CCGCAGCCCACCCCACCCATATT No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019894_1048019912 21 Left 1048019894 8:130528381-130528403 CCACCCCCGCAGCCCACCCCACC No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019893_1048019912 22 Left 1048019893 8:130528380-130528402 CCCACCCCCGCAGCCCACCCCAC No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019896_1048019912 17 Left 1048019896 8:130528385-130528407 CCCCGCAGCCCACCCCACCCATA No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019890_1048019912 28 Left 1048019890 8:130528374-130528396 CCCAGCCCCACCCCCGCAGCCCA No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019900_1048019912 8 Left 1048019900 8:130528394-130528416 CCACCCCACCCATATTCCTTTAG No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019910_1048019912 -8 Left 1048019910 8:130528410-130528432 CCTTTAGAGAGGGAGGGTTCTCT No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data
1048019897_1048019912 16 Left 1048019897 8:130528386-130528408 CCCGCAGCCCACCCCACCCATAT No data
Right 1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048019912 Original CRISPR GGTTCTCTGCAGAAATTGGC TGG Intergenic
No off target data available for this crispr