ID: 1048022207

View in Genome Browser
Species Human (GRCh38)
Location 8:130549618-130549640
Sequence CTCAATCCAACAACCTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048022207_1048022214 10 Left 1048022207 8:130549618-130549640 CCCTCACAGGTTGTTGGATTGAG No data
Right 1048022214 8:130549651-130549673 CCTCACTGGCTGCTGGACTGAGG No data
1048022207_1048022211 -4 Left 1048022207 8:130549618-130549640 CCCTCACAGGTTGTTGGATTGAG No data
Right 1048022211 8:130549637-130549659 TGAGGGTGTTAATTCCTCACTGG No data
1048022207_1048022215 11 Left 1048022207 8:130549618-130549640 CCCTCACAGGTTGTTGGATTGAG No data
Right 1048022215 8:130549652-130549674 CTCACTGGCTGCTGGACTGAGGG No data
1048022207_1048022212 3 Left 1048022207 8:130549618-130549640 CCCTCACAGGTTGTTGGATTGAG No data
Right 1048022212 8:130549644-130549666 GTTAATTCCTCACTGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048022207 Original CRISPR CTCAATCCAACAACCTGTGA GGG (reversed) Intergenic
No off target data available for this crispr