ID: 1048022264

View in Genome Browser
Species Human (GRCh38)
Location 8:130550148-130550170
Sequence AATTTCCAATGGTTCCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048022264_1048022274 26 Left 1048022264 8:130550148-130550170 CCTTTGAGGAACCATTGGAAATT No data
Right 1048022274 8:130550197-130550219 GTGAGGTTTAGGAGGTGATCAGG No data
1048022264_1048022270 1 Left 1048022264 8:130550148-130550170 CCTTTGAGGAACCATTGGAAATT No data
Right 1048022270 8:130550172-130550194 AGAAGGATGGGAACTTACTTGGG No data
1048022264_1048022271 9 Left 1048022264 8:130550148-130550170 CCTTTGAGGAACCATTGGAAATT No data
Right 1048022271 8:130550180-130550202 GGGAACTTACTTGGGACGTGAGG No data
1048022264_1048022269 0 Left 1048022264 8:130550148-130550170 CCTTTGAGGAACCATTGGAAATT No data
Right 1048022269 8:130550171-130550193 CAGAAGGATGGGAACTTACTTGG No data
1048022264_1048022272 15 Left 1048022264 8:130550148-130550170 CCTTTGAGGAACCATTGGAAATT No data
Right 1048022272 8:130550186-130550208 TTACTTGGGACGTGAGGTTTAGG No data
1048022264_1048022273 18 Left 1048022264 8:130550148-130550170 CCTTTGAGGAACCATTGGAAATT No data
Right 1048022273 8:130550189-130550211 CTTGGGACGTGAGGTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048022264 Original CRISPR AATTTCCAATGGTTCCTCAA AGG (reversed) Intergenic
No off target data available for this crispr