ID: 1048022266

View in Genome Browser
Species Human (GRCh38)
Location 8:130550159-130550181
Sequence CCATCCTTCTGAATTTCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048022266_1048022271 -2 Left 1048022266 8:130550159-130550181 CCATTGGAAATTCAGAAGGATGG No data
Right 1048022271 8:130550180-130550202 GGGAACTTACTTGGGACGTGAGG No data
1048022266_1048022274 15 Left 1048022266 8:130550159-130550181 CCATTGGAAATTCAGAAGGATGG No data
Right 1048022274 8:130550197-130550219 GTGAGGTTTAGGAGGTGATCAGG No data
1048022266_1048022270 -10 Left 1048022266 8:130550159-130550181 CCATTGGAAATTCAGAAGGATGG No data
Right 1048022270 8:130550172-130550194 AGAAGGATGGGAACTTACTTGGG No data
1048022266_1048022272 4 Left 1048022266 8:130550159-130550181 CCATTGGAAATTCAGAAGGATGG No data
Right 1048022272 8:130550186-130550208 TTACTTGGGACGTGAGGTTTAGG No data
1048022266_1048022273 7 Left 1048022266 8:130550159-130550181 CCATTGGAAATTCAGAAGGATGG No data
Right 1048022273 8:130550189-130550211 CTTGGGACGTGAGGTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048022266 Original CRISPR CCATCCTTCTGAATTTCCAA TGG (reversed) Intergenic
No off target data available for this crispr