ID: 1048022270

View in Genome Browser
Species Human (GRCh38)
Location 8:130550172-130550194
Sequence AGAAGGATGGGAACTTACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048022266_1048022270 -10 Left 1048022266 8:130550159-130550181 CCATTGGAAATTCAGAAGGATGG No data
Right 1048022270 8:130550172-130550194 AGAAGGATGGGAACTTACTTGGG No data
1048022264_1048022270 1 Left 1048022264 8:130550148-130550170 CCTTTGAGGAACCATTGGAAATT No data
Right 1048022270 8:130550172-130550194 AGAAGGATGGGAACTTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048022270 Original CRISPR AGAAGGATGGGAACTTACTT GGG Intergenic
No off target data available for this crispr