ID: 1048022271

View in Genome Browser
Species Human (GRCh38)
Location 8:130550180-130550202
Sequence GGGAACTTACTTGGGACGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048022266_1048022271 -2 Left 1048022266 8:130550159-130550181 CCATTGGAAATTCAGAAGGATGG No data
Right 1048022271 8:130550180-130550202 GGGAACTTACTTGGGACGTGAGG No data
1048022264_1048022271 9 Left 1048022264 8:130550148-130550170 CCTTTGAGGAACCATTGGAAATT No data
Right 1048022271 8:130550180-130550202 GGGAACTTACTTGGGACGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048022271 Original CRISPR GGGAACTTACTTGGGACGTG AGG Intergenic
No off target data available for this crispr