ID: 1048022274 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:130550197-130550219 |
| Sequence | GTGAGGTTTAGGAGGTGATC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048022264_1048022274 | 26 | Left | 1048022264 | 8:130550148-130550170 | CCTTTGAGGAACCATTGGAAATT | No data | ||
| Right | 1048022274 | 8:130550197-130550219 | GTGAGGTTTAGGAGGTGATCAGG | No data | ||||
| 1048022266_1048022274 | 15 | Left | 1048022266 | 8:130550159-130550181 | CCATTGGAAATTCAGAAGGATGG | No data | ||
| Right | 1048022274 | 8:130550197-130550219 | GTGAGGTTTAGGAGGTGATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048022274 | Original CRISPR | GTGAGGTTTAGGAGGTGATC AGG | Intergenic | ||
| No off target data available for this crispr | |||||