ID: 1048025846

View in Genome Browser
Species Human (GRCh38)
Location 8:130586035-130586057
Sequence GACCACTCCTGGTATCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048025844_1048025846 2 Left 1048025844 8:130586010-130586032 CCTTGTCATGAAAAGGAGGTTGT No data
Right 1048025846 8:130586035-130586057 GACCACTCCTGGTATCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048025846 Original CRISPR GACCACTCCTGGTATCCACC AGG Intergenic
No off target data available for this crispr